Cryptococcus terreus di Menna (ATCC® 34145)

Strain Designations: CR 44  /  Product Format: freeze-dried

Strain Designations CR 44
Application
Biomedical Research and Development Material
Biosafety Level 2

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Comments
Identification
Medium ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 28: Emmons' modification of Sabouraud's agar
ATCC® Medium 1245: YEPD
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

CTCATATACTCTACAGTTCACGGGTAGATTACTTAGCAGGCCTGGCGAAGACAACACGCATGATGTATAATCAATGATCTCTTCTGAGGTGAACCTGCGGAAGGATCATTAGTGTATTACACATGCTTGGTGTCTTCGCTTCGGCAAGGCCCTTGCTTAAATCACATCCTAACACCTGTGAACTGTAAGACGTATGATGAGGTCTTTGGCCAAGTCATCGTCTGCCCATTTTTAACAAACAATTAATGTAACAAACGTAGTCTTATTATAACCTAATAAAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCTTTGGTATTCCGAAGAGCATGCCTGTTTGAGTGTCATGAAAATATCAACCTTGACTTGGGTTTTGTGCTCTAGTCTTGGCTTGGAATTGGGTGCTTGCCGCTTTTACGAGCGGCTCACCTTAAATGTATTAGCTGGATCTGTCTTTGAGACTTGGTTTGACTTGGCGTAATAAGTATTTCGCTAAGGACATTCTTCGGAGGGGCCTCGTTTCTAGGACGCTTGTCCGCTTCCCAATACAAGTTCCACCTCGTGGACATGACTTTTTATTATCTGGCCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGAGAGAAATTAGTGAATTAAACATGCTTGGTGTCTTGCCTTCGGCAGGCCTGCTTAATAAATCTACACCNTGAACGTAGACGTATGATGAGGTTTGGGCAGTTTCTCGCATTTTAACAACATAATGTACAACGT

Name of Depositor GD Roberts
Isolation
clinical specimen, Minnesota, USA
Cross References

Nucleotide (GenBank) : EU252548 ITS including 5.8S rRNA gene

References

Roberts GD, et al. Evaluation of the API 20 c microtube system for the identification of clinically important yeasts. J. Clin. Microbiol. 3: 302-305, 1976. PubMed: 1270593

McTaggart LR, et al. Rapid identification of Cryptococcus neoformans and Cryptococcus gattii by matrix-assisted laser desorption ionization-time of flight mass spectrometry. J. Clin. Microbiol. 49: 3050-3053, 2011. PubMed: 21653762