Filobasidiella neoformans Kwon-Chung, teleomorph (ATCC® 28958)

Strain Designations: NIH 430 [CBS 6886, MUCL 30453]  /  Product Format: freeze-dried

Deposited As Filobasidiella neoformans Kwon-Chung
Strain Designations NIH 430 [CBS 6886, MUCL 30453]
Application
Biomedical Research and Development Material
Biosafety Level 2

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain yes
Antigenic Properties Serotype D
Preceptrol® no
Mating Type a (mates with ATCC 28957)
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

ATAAACCACCGTCCTCATATACTCTACTGATCCTTCCGTAGGTGAACCTGCGGAAGGATCAGTAGAGAATATTGGACTTCGGTCCATTTATCTACCCATCTACACCTGTGAACTGTTTATGTGCTTCGGCACGTTTTACACAAACTTCTAAATGTAATGAATGTAATCTTATTATAACAATAATAAAACTTTCAACAACGGATCTCTTGGCTTCCACATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCAACTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGAGTCATGAAAATCTCAATCCCTCGGGTTTTATTACCTGTTGGACTTGGATTTGGGTGTTTGCCGCGACCTGCAAAGGACGTCGGCTCGCCTTAAATGTGTTAGTGGGAAGGTGATTACCTGTCAGCCCGGCGTAATAAGTTTCGCTGGGCCTATGGGGTAGTCTTCGGCTTGCTGATAACAACCATCTCTTTTTGTTTGACCTCAAATCAGGTAGGGCTACCCGCTGAACTTAAGCATATCAATAAGCGGAAGGAATTCGTAAAAAA

Name of Depositor KJ Kwon-Chung
Isolation
Pigeon droppings, Denmark
Cross References

Nucleotide (GenBank) : EU240004 ITS including 5.8S rRNA gene

References

Bovers M, et al. Promiscuous mitochondria in Cryptococcus gattii. FEMS Yeast Res. 9: 489-503, 2009. PubMed: 19281475

Bovers M, et al. Six monophyletic lineages identified within Cryptococcus neoformans and Cryptococcus gattii by multi-locus sequence typing. Fungal Genet Biol 45: 400-421, 2008. PubMed: 18261945

Kavanaugh LA, Fraser JA, Dietrich FS. Recent evolution of the human pathogen Cryptococcus neoformans by intervarietal transfer of a 14-gene fragment. Mol Biol Evol 23: 1879-1890, 2006. PubMed: 16870684

Diaz MR, et al. Comparative analysis of the intergenic spacer regions and population structure of the species complex of the pathogenic yeast Cryptococcus neoformans. FEMS Yeast Res 5: 1129-1140, 2005. PubMed: 16061425

Chaturvedi S, et al. Direct PCR of Cryptococcus neoformans MATalpha and MATa pheromones to determine mating type, ploidy, and variety: a tool for epidemiological and molecular pathogenesis studies. J. Clin. Microbiol. 38: 2007-2009, 2000. PubMed: 10790143

Diaz MR, et al. Molecular sequence analyses of the intergenic spacer (IGS) associated with rDNA of the two varieties of the pathogenic yeast, Cryptococcus neoformans. Syst Appl Microbiol 23: 535-545, 2000. PubMed: 11249024

Suh SO, Sugiyama J. Phylogeny among the basidiomycetous yeasts inferred from small subunit ribosomal DNA sequence. J. Gen. Microbiol. 139: 1595-1598, 1993. PubMed: 8371119

Mitchell TG, et al. Comparison of 5.8S ribosomal DNA sequences among the basidiomycetous yeast genera Cystofilobasidium, Filobasidium and Filobasidiella. J. Med. Vet. Mycol. 30: 207-218, 1992. PubMed: 1355536

Van de Peer Y, et al. Evolution of basidiomycetous yeasts as deduced from small ribosomal subunit RNA sequences. Syst Appl Microbiol 15: 250-258, 1992.

Schmeding KA, et al. Sexual compatibility between serotypes of Filobasidiella neoformans (Cryptococcus neoformans). Curr. Microbiol. 5: 133-138, 1981.

Kwon-Chung KJ. A new genus, Filobasidiella, the perfect state of Cryptococcus neoformans. Mycologia 67: 1197-1200, 1975. PubMed: 765816