Scedosporium aurantiacum (ATCC® 28206)

Strain Designations: VH/6199/74  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Deposited As Monosporium apiospermum Saccardo, anamorph
Strain Designations VH/6199/74
Application
Biomedical Research and Development Material
Biosafety Level 2

Biosafety  classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Morphology On Emmons’modification of Sabouraud’s medium at 25°C after 3 days, mycelium white to dingy white becoming pale gray, velutinous, slightly raised. Reverse tan. Hyphae hyaline, guttulate. Conidia subhyaline, elongated ellipsoidal to broadly ovoid, smooth, contain oil dropplets, 8.25-10.5 X 3.75-6 µm.
Medium ATCC® Medium 28: Emmons' modification of Sabouraud's agar
Growth Conditions
Temperature: 25°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

AGGGATCATTACAGAGTTACTACTCCAAACCCATTGTGAACCTTACCTATGTTCTGTTGCCTCGGCGGGGCGGTCGGCGCCCCCTCTCCGCGAGGAGGGGAGACGATGGACCCCCCGCCGGCAGCACCAAACTCTTGAATTTTATAGCGGATTACAAGCTCTGATTGGAAAACAAAAAAACAAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGGCAGTAATCTGCCGGGCATGCCTGTCCGAGCGTCATTTCAACCCTCGAACCTCTGTTTCCCAGCGAAGCTCAGGGTCGGCGTTGGGGCGCTACGGCGAGTCTTCGCGACCCCGTAGGCCCTGAAATACAGTGGCGGTCCCGCCGCGGTTGCCTTCTGCGTAGTAAAAGTCTTCTTTTGCAAGCTTCGCATTGGGTCCCGGCGGAGGCCTGCCGTCAAACCACATTATAACTTAAGATGGTTTGACCTCGGATCAGGTAGGGTTACCCGCTGAACTTAA


D1D2 region of the 28S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCAGCCTCCGGGCGGTCCGAGTTGTAATTTGAAGAGGATGCTTTTGGCGAGGCGCCTTCCGAGTGCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTATGGTTGGACGCCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAACCCCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGACTTGTGCCCGTCGAATCAGCCGCCGCTCGTCGGCGGCGCACTTCGGCGGGCTCAGGCCAGCATCAGTTCGCTGCAGGGGGAGAAAGGCGGTGGGAATGTGGCTCTTCGGAGTGTTATAGCCCGCCGCGCAATACCCCTCGGCGGACTGAGGACCGCGCATCTGCAAGGATGCTGGCGTAATGGTCGTCAGCGA

Morphology On Emmons’modification of Sabouraud’s medium at 25°C after 3 days, mycelium white to dingy white becoming pale gray, velutinous, slightly raised. Reverse tan. Hyphae hyaline, guttulate. Conidia subhyaline, elongated ellipsoidal to broadly ovoid, smooth, contain oil dropplets, 8.25-10.5 X 3.75-6 µm.
Name of Depositor A Bakerspigel
Isolation
Sputum and lung tissue, Canada
Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation