Phialophora verrucosa Medlar (ATCC® 28182)

Strain Designations: 303 [45229]  /  Product Format: freeze-dried

Deposited As Phialophora verrucosa Medlar, anamorph
Strain Designations 303 [45229]
Application
Biomedical Research and Development Material
Biosafety Level 2

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Type Strain no
Preceptrol® no
Medium ATCC® Medium 307: Cornmeal agar
Growth Conditions
Temperature: 25.0°C
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal   transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

TGCGGAAGGATCATTAACGAGTTAGGGTCTCTCCAGGCCCGACCTCCCAACCCTTTGTCTACCTTGCTGCATGTTGCTTTGGCGGACCCGTCTCACGACCGCCCTGGGACCGCCGAGAGGCGTCCCTAGGCCCGTGTCCGCCGATAGCCAACCTAAACTCTTGGATGAATCGTGTTTTATGTCTGAGTCTTGTGATTAAATCAAAAGCAAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGCGAATTGCAGAATTCCCGTGAGTCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTATCACCCCTCAAGCCCCGTGCTTGGTGTTGGACGGATCTTGGTCGTGTGATCGCGACCCCTCCTAAAGACAATGACGGCGGCCTGTGGATCCCCCGGTACACTGAGCTTTTAACTGAGCACGTATCGGACAAGGGCGCCCAGGACCCGGTCCTTCTCCTTTAACCAGGAAATTTCTTCAAGGTTGACCTCGGATCAGGTAGGAATACGCGCTGAACTTAAGCATATCAATA

Name of Depositor MA Gordon
References

Salkin IF. Dermatophyte test medium: evaluation with nondermatophytic pathogens. Appl. Microbiol. 26: 134-137, 1973. PubMed: 4795526