Fonsecaea pedrosoi (Brumpt) Negroni (ATCC® 28174)

Strain Designations: 194-A [CBS 557.76]  /  Product Format: freeze-dried

Strain Designations 194-A [CBS 557.76]
Application
Biomedical Research and Development Material
Biosafety Level 2

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Medium ATCC® Medium 307: Cornmeal agar
ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 336: Potato dextrose agar (PDA)
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

AAGGATCATTAATGAGTTAGGGTCTTCTAGGCCCGACCTCCCAACCCTTTGTTTACTAGACCTCAGTTGCTTCGGCAGGCCCGTCTTAATCTGACCGCCGGAGGACCGCCTAATACGGGTGTTGCCTCTGGCCAGTGTCTGCCGATAGCCTCATCTCCTAATTCTGGATCAATCATGATTTACAATGTCTAAGTGATTTTATTCAATTAAAGCAAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGCGAATTGCAGAATTCCAGTGAGTCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTCGAGCGTCATTATCACCCCCTCAAGCCCCTGCGCTTGGTGTTGGACGGCTTGGTGGAGCGAGTTCACACTTTCCACCCCTCCTAAAGACAATGACGGCGGCCTGCGGAACCCCCGGTACACTGAGCTTCTTAACTGAGCACGTATCGGATGAAGGGTGCCCGGGACCCGGTCTTCTCCCTCACGGGAACACTTTTTTCTAAGGTTGACCTCGGATCAGGTAGGAATACGCGCTGAACTTAAG


D1D2 region of the 28S ribosomal RNA gene

CATATCAATAAGCGCAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTCTTGGGGTCCGAGTTGTAATTTGTAGAGGATGTTTCGGGTACCGCCTCGGTTTAAATTTCTTGGAACAGAATGTCAAAGAGGGTGAGAATCCCGTCTTGGACCGGCGGTAGGGCCTATGTGAAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGAGCGCGGCGGTTCCCCCTTGCTTCTGCTTGGGTTACTCCGCCGTGTCCAGGCCAACATCGGTTCTGGGGGTCGGTCAAAGGCTCTGGGAATGTATCTACCCACGGGTAGACTTATAGACCAGGGTGTCATGCGACCTCCCGGGACCGAGGAACGCGCTTCGGCTCGGATGTTGGCGTAATGGTTGTCAGCGA

Name of Depositor MA Gordon