Arthroderma vanbreuseghemii Takashio, teleomorph (ATCC® 28145)

Alternate State: Trichophyton mentagrophytes (Robin) Blanchard, anamorph, Trichophyton mentagrophytes var. interdigitale (Priestley) Georg, anamorph  /  Strain Designations: [CBS 646.73; RV 27960, NCPF 452, SA 181]  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Strain Designations [CBS 646.73; RV 27960, NCPF 452, SA 181]
Alternate State Trichophyton mentagrophytes (Robin) Blanchard, anamorph, Trichophyton mentagrophytes var. interdigitale (Priestley) Georg, anamorph
Application
Biomedical Research and Development Material
Biosafety Level 2
Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain yes
Preceptrol® no
Mating Type plus
Morphology On Emmons Modification of Sabouraud’s medium at 25°C after 6 days, mycelium white to creamy white, cottony, dense. Reverse buff to yellow. Hyphae hyaline. Macroconidia hyaline, elongated ovoid, smooth, 2-3 septate, 11-15 X 4 µm. Microconidia hyaline, tear-shaped, smooth, 4-7 X 3-4 µm.
Medium ATCC® Medium 28: Emmons' modification of Sabouraud's agar
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

AAGGATCATTAACGCGCAGGCCGGAGGCTGGCCCCCCACGATAGGGCCAAACGTCCGTCAGGGGTGAGCAGATGTGCGCCGGCCGTACCGCCCCATTCTTGTCTACCTTACTCGGTTGCCTCGGCGGGCCGCGCTCTCTCAGGAGAGCCGTTCGGCGAGCCTCTCTTTAGTGGCTCAACGCTGGACCGCGCCCGCCGGAGGACAGACGCAAAAAAATTCTTTCAGAAGAGCTGTCAGTCTGAGCGTTAGCAAGCAAAAATCAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGCATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCAGCCCCTCAAGCCCGGCTTGTGTGATGGACGACCGTCCGGCGCCCCCGTCTTTGGGGGTGCGGGACGCGCCCGAAAAGCAGTGGCCAGGCCGCGATTCCGGCTTCCTAGGCGAATGGGCAACAAACCAGCGCCTCCAGGACCGGCCGCCCTGGCCTCAAAATCTGTTTTATACTTATCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA


D1D2 region of the 28S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAATCTGGCCTCCCCCGGGGGCCCGAGTTGTAATTTGCAGAGGATGCTTCGGGTGCGGCCGCCGTCTAAGTTCCTTGGAACAGGACGTCAGAGAGGGTGAGAATCCCGTCTTGGGCGGGCGGTCCGCGCCCGTGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGCGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGGTTAAAAGCACCTTGAAAAGGGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCGGCCAGACTCGGGGGCGGGGTTCAGCGGGTGCTCGTCGCCCGTGTATTCCTCGTCTCCCGGGCCAGCATCAGTTTCGACGGCCGGTCAAAGGCCCCCGGAATGTGTCGTCTCTCGGGACGTCTTATAGCCGGGGGTGCAATGCGGCCCGTCGGGACTGAGGAACGCGCTCCGGCTCGGATGCTGGCGTAATGGCCGTAAGCGG

Morphology On Emmons Modification of Sabouraud’s medium at 25°C after 6 days, mycelium white to creamy white, cottony, dense. Reverse buff to yellow. Hyphae hyaline. Macroconidia hyaline, elongated ovoid, smooth, 2-3 septate, 11-15 X 4 µm. Microconidia hyaline, tear-shaped, smooth, 4-7 X 3-4 µm.
Name of Depositor AA Padhye
Chain of Custody
ATCC <-- AA Padhye <-- CBS 646.73 <-- M. Takashio RV 27960
Isolation
Monascospore isolate from ATCC 24953 X ATCC 24957.
References

. . Ann. Soc. Belge Med. Trop. 53: 547, 1973.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation