Microsporum audouinii Gruby (ATCC® 26837)

Strain Designations: 18499/6  /  Product Format: frozen

Deposited As Microsporum langeronii Vanbreuseghem
Strain Designations 18499/6
Application
Biomedical Research and Development Material
Biosafety Level 2

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Comments
Dermatomycosis
Medium ATCC® Medium 28: Emmons' modification of Sabouraud's agar
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

AAGGATCATTAACGCGCAAGAGGTCGAAGTTGGCCCCCGAAGCTCTTCCGTCTCCCCCCCGGGCCTCCCGGGGAGGTTGCGGGCGGCGAGGGGTGCCTCCGGCCGCACGCCCATTCTTGTCTACTGACCCGGTTGCCTCGGCGGGCCGCGCCTGCTGTGCTACAGCGGCCGTTCGGGGGGGACGCCTGAGGGGGACTTTTGTTTCCTAGGCCACGCCCCGGGCAGCGCTCGCCGGAGGATTACTCTGGAAAACACACTCTTGAAAGAACATACCGTCTGAGCGAGCAACGCAAATCAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGCATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCAACCCCTCAAGCCCGGCTTGTGTGATGGACGACCGTCCCCCCCCAATAACCACCCACCGCTTAGGGGGGTGGGAGGGAGGGGGACGCGCCCGAAAAGCAGTGGTCAGGCCGCGATTCCGGCTCCTGGGCGAATGGGACATACCACCGCCTCTAGGACCGGCCGGTAGGCTGGCCTAACGCACCATGTATTATTCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA


D1D2 region of the 28S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAATCTGGCCTCCCTTGGGGGGTCCGAGTTGTAATTTGTAGAGGATGCTTCGGGTGTGGCCGCCGTCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTCTTGGGCGGCCGGCCCGCGCCCGTGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGCGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGGTTAAAAGCACCTTGAAAAGGGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCGGCCAGACTCGAGGGGCGGGGTTCAGCGGGTGCGCGTCACCCGTGCACTCCCCGTCCCCTCGGGCCAGCATCAGTTTCGACGGCCGGTCAAAGGCCCCCGGAATGTGTCGTCTCTAGGGACGTCTTATAGCCGGGGGTGCAATGCGGCCCGCCGGGACTGAGGAACGCGCTCCGGCTCGGATGCTGGCGTAATGGCCGTAAGCGG

Name of Depositor D Grigoriu
Isolation
Human isolate, Switzerland
References

Grigoriu D, et al. Fungal species imported to Switzerland. Sabouraudia 10: 209-211, 1972. PubMed: 4565440