Scytalidium dimidiatum (Penzig) Sutton et Dyko, anamorph (ATCC® 26226)

Strain Designations: 328/8/70  /  Product Format: freeze-dried

Deposited As Hendersonula toruloidea Nattrass, anamorph
Strain Designations 328/8/70
Application
Biomedical Research and Development Material
Biosafety Level 2

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Morphology On PDA medium at 25°C after 7 days, mycelium white to grayish white, cottony, dense. Reverse creamy white. Hyphae hyaline to dark brown, guttulate. Conidia hyaline to dark reddish brown, ovoid to broadly ellipsoid, smooth, 9 X 5.5-6 µm. Arthroconidia doliiform to cylindrical, dark reddish brown, smooth, 12-13.5 X 3-7.5 µm.
Medium ATCC® Medium 336: Potato dextrose agar (PDA)
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

AAGGATCATTACCGAGTTGATTCGGGCTCCGGCCCGATCCTCCCACCCTTTGTGTACCCACCTCTGTTGCTTTGGCGGGCCGCGGTCCTCCGCGGCCGCCCTCCGTCCGGGGGGTGGCCAGCGCCCGCCAGAGGACCATCGAACTCCGGTCAGTGAACGTTGCCGTCTGAAAAACAATCAATAAACTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTCGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTACAACCCTCAAGCTCTGCTTGGTGTTGGGCACCGCCCTTCCGCGGGCGCGCCTCAAAGACCTCGGCGGTGGCGTCTTGCCTCGAGCGTAGTAGAAAACACCTCGCTTTGGAGCGCACGGCGCCGCCCGCCGGACGAACCTTTTGAACTTTCTCAAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA


D1D2 region of the 28S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAAGCTGGCCCCCCCGGGGGTCCGCGTTGTAATTTGTAGAGGATGATTCGGCGAGGGCTCCCGCCTAAGTCCCCTGGAACGGGGCGTCATAGAGGGTGAGAATCCCGTATGCGGTGGGCTGCCTTAGCCATGTGAATCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGTCCGCAGTTGCTCAGCCGGTCTCCTGACCGGCGCACTCTTCTGCGGCCAGGCCAGCATCAGTTCGGGCGGTCGGATAAAGGCCCCGGGAACGTAGCTCCTCTCGGGGAGTGTTATAGCCCGGGGTGGAATGCGGCCAGCCTGGACTGAGGATCTCGCTTCGGCTAGGATGCTGGCGTAATGGCTGTAAGCGG

Morphology On PDA medium at 25°C after 7 days, mycelium white to grayish white, cottony, dense. Reverse creamy white. Hyphae hyaline to dark brown, guttulate. Conidia hyaline to dark reddish brown, ovoid to broadly ellipsoid, smooth, 9 X 5.5-6 µm. Arthroconidia doliiform to cylindrical, dark reddish brown, smooth, 12-13.5 X 3-7.5 µm.
Name of Depositor FM Rush-Munro
Isolation
Onychomycosis, New Zealand