Epidermophyton floccosum (Harz) Langeron et Milochevitch (ATCC® 26072)

Product Format: frozen

Deposited As Epidermophyton floccosum var. nigricans Fragner
Application
Biomedical Research and Development Material
Biosafety Level 2

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain yes
Preceptrol® no
Comments
Mitochondrial genome sequencing completed.
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAACGCGCAGGCCGCAGTCGGCCCGTCCCCCTTCTCTCTGAATGCTGGACGGTGTCGCCGGCCACACGCCCATTCTTGTCTACACTACCCGGTTGCCTCGGCGGGCCGCGCCCCCTAGGCTGCAGTGTCGCTGCAGCGTCTCGGGGGGGCCGTTCGGGGGATGGAGAAGGATGCCCCGGCGGGGTTGATCGCTCCCCCACCCCTGGACAGCGCTCGCCGAAGGAGTGATTCTCAGAAATTCTACGAAATCTCCATAGGTGGTTCAGTCTGAGCGTTGGCAAGCAAAAACCAGTCAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCAACCCCTCAAGCCCGGCTTGTGTGATGGACGACCGTCCGACCGCCTTTGCATCCCCCGTTCCACCGGGAGAGGAGAAAGGTGGAGGGGACGCGCCCGAAAAGCAGTGGCCAGGCCGCGATTCCGGGCCCCTGGGCGAATGGGCAACAAAACCAGCGCCTTCAGGACCGGCCGGCTCTCTGGCCCTAGTTTCCGTCGGGAGGACGAAAGGGGGCGACCCCTCTCTCCCCTCCGCATTCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAA


D1D2 region of the 28S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAATCTGGCCTCCTCCGGGGGTCCGAGTTGTAATTTGTAGAGGATGCTTCGGGTGCGGCCGCCGTCTAAGTTCCTTGGAACAGGACGTCAGAGAGGGTGAGAATCCCGTCTTGGGCGGCCGGCGCGCGCCCGTGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGCGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGGTTAAAAGCACCTTGAAAAGGGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCGGCCAGACTCGGGGGGCGGGGTTCAGCGGGCGCTCGTCGCCCGTGCACTCCCCGCGTTCCCGGGCCAGCATCAGTTTCGACGGCCGGTCAAAGGCCCCCGGAATGTGTCGTCTCTAGGGACGTCTTATAGCCGGGGGTGCAATGCGGCCCGTCGGGACTGAGGAACGCGCTCCGGCTCGGATGCTGGCGTAATGGTCGTAAGCGGC

Name of Depositor M Hejtmanek
Chain of Custody
ATCC <-- M Hejtmanek <-- P. Fragner
Isolation
Human foot
References

. . Ceska Mykol. 22: 203, 1968.

Tambor JH, et al. The complete DNA sequence of the mitochondrial genome of the dermatophyte fungus Epidermophyton floccosum. Curr. Genet. 49: 302-308, 2006. PubMed: 16450111

Rakeman JL, et al. Multilocus DNA sequence comparisons rapidly identify pathogenic molds. J Clin Microbiol 43: 3324-3333, 2005. PubMed: 16000456