Trichophyton interdigitale Priestley (ATCC® 24953)

Strain Designations: RV 24720  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Deposited As Trichophyton mentagrophytes (Robin) Blanchard
Strain Designations RV 24720
Application
Biomedical Research and Development Material
Biosafety Level 2

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Mating Type mating type plus
Comments
Taxonomy
Mating experiments with Arthroderma benhamiae
This fungus was re-identified based on the multigene sequence comparisons.
Morphology After 10 days at 25°C colonies thin, floccose, white. Conidia rare, spherical to tear-shaped. Small nodular clumps of cells, surrounded by yellowish exudate, frequently present, particularly in non-sporulating strains
Medium ATCC® Medium 28: Emmons' modification of Sabouraud's agar
ATCC® Medium 200: YM agar or YM broth
Growth Conditions
Temperature: 25°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAACGCGCAGGCCGGAGGCTGGCCCCCCACGATAGGGCCAAACGTCCGTCAGGGGTGAGCAGATGTGCGCCGGCCGTACCGCCCCATTCTTGTCTACATTACTCGGTTGCCTCGGCGGGCCGCGCTCTCCCAGGAGAGCCGTTCGGCGAGCCTCTCTTTAGTGGCTAAACGCTGGACCGCGCCCGCCGGAGGACAGACGCAAAAAAATTCTTTCAGAAGAGCTGTCAGTCTGAGCGTTAGCAAGCAAAAATCAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGCATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCAGCCCCTCAAGCCCGGCTTGTGTGATGGACGACCGTCCGGCGCCCCCGTCTTTGGGGGTGCGGGACGCGCCCGAAAAGCAGTGGCCAGGCCGCGATTCCGGCTTCCTAGGCGAATGGGCAACAAACCAGCGCCTCCAGGACCGGCCGCCCTGGCCTCAAAATCTGTTTTATACTTATCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAA


D1D2 region of the 28S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAATCTGGCCTCCCCCGGGGGCCCGAGTTGTAATTTGCAGAGGATGCTTCGGGTGCGGCCGCCGTCTAAGTTCCTTGGAACAGGACGTCAGAGAGGGTGAGAATCCCGTCTTGGGCGGGCGGTCCGCGCCCGTGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGCGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGGTTAAAAGCACCTTGAAAAGGGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCGGCCAGACTCGGGGGCGGGGTTCAGCGGGTGCTCGTCGCCCGTGTATTCCTCGTCTCCCGGGCCAGCATCAGTTTCGACGGCCGGTCAAAGGCCCCCGGAATGTGTCGTCTCTCGGGACGTCTTATAGCCGGGGGTGCAATGCGGCCCGTCGGGACTGAGGAACGCGCTCCGGCTCGGATGCTGGCGTAATGGCCGTAAGCGGC


beta-tubulin gene

CTAGCTTTCCCCCTGTCCATCACTTCCCCTCTATTTGTGCCCGAAAAACACGACACGGTCTGCACAGGCCAAGAAAGGGGGGGAGGCGAGGGCCACCACACGACCACGTCCCAGCGTGAAGGGGACAGGCTTCGAGTTTCACAATTCTCGCATAGCGAGCTTCGAGCATCAGGCTAACGTGCATTTATCGTATAGGTCCATCTCCAAACCGGCCAATGTGTAAGCTTTGATCGTTCCCTGGTTCGTTCTCAGGTACCCGTTTGAGTTAACAATTGTTCGACATTAGGGTAACCAAATTGGTGCTGCTTTCTGGTGAGCATTCATGCGTTGCAGCATAATTGTATATTTCGTGTCGAGTTGTTACTGACTTGGTTTACAGGCAAACCATTGCTGGTGAGCACGGTCTCGATGGATCCGGCCAGTGAGTGATTCTGCAAGAAAAAGTTCCGGTCTTGAGGGACTTGAACGTTGACAACTGGGATTTCTATAGCTACACCGGATCTTCTGACCTCCAATTGGAGCGCATGAATGTCTACTTCAACGAGGTGTGCACGACCAAGACCCTTCCCTTCAGCAGCATACTAACTCATTGGAGGCAAAGGCCTCAAGCAAAAAATACGTTCCCCGTGCGGTTCTTGTTGATCTTGAGCCCGCCGCTCTCGATGCTGTCCGCGCCGGTCCTTTTGGTCAGCTCTTCCGCCCCGATAACGTCGTCTTCGGTCAGTCTGGTGCCGGAAACAACTGG

Morphology After 10 days at 25°C colonies thin, floccose, white. Conidia rare, spherical to tear-shaped. Small nodular clumps of cells, surrounded by yellowish exudate, frequently present, particularly in non-sporulating strains
Name of Depositor R Vanbreuseghem
Chain of Custody
ATCC <-- R Vanbreuseghem <-- Dr. Campos-Magalhaes
Isolation
Human, Mozambique
Cross References

Nucleotide (GenBank) : KJ606109 ITS including 5.8S rRNA gene

Nucleotide (GenBank) : KJ606157 D1/D2 region of 28S rRNA gene

Nucleotide (GenBank) : KJ606205 beta-tubulin gene

References

Takashio M. Is Arthroderma benhamiae the perfect state of Trichophyton mentagrophytes?. Sabouraudia 10: 122-127, 1972. PubMed: 5043957

Takashio M. Etudes des phénoménes de reproduction liés au vieillissement et au rajeunissement des cultures de champignons. Ann Soc Belge Med Trop 53: 427-580, 1973.

Beguin H, et al. The taxonomic status of Trichophyton quinckeanum and T. interdigitale revisited: a multigene phylogenetic approach. Med Mycol 50: 871-882, 2012. PubMed: 22587727

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation