Penicillium marneffei Segretain et al. (ATCC® 201564)

Strain Designations: SB0501  /  Product Format: frozen

Permits and Restrictions

View Permits

Deposited As Penicillium marneffei Segretain et al., anamorph
Strain Designations SB0501
Application
Biomedical Research and Development Material
Emerging infectious disease research
Biosafety Level 2

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Comments
DNA type II by restriction endonuclease analysis
Morphology Colonies dense on Potato dextrose agar at 25°C after 4-5 days mycelium white, produces red soluble pigment and dark red reverse with greenish-grey sporulating areas. Phialides ampulliform. Conidia globose and smooth walled.
Medium ATCC® Medium 336: Potato dextrose agar (PDA)
Growth Conditions
Temperature: 24°C 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

TCCGTAGGTGAACCTGCGGAAGGATCATTACCGAGTGCGGGCCCTCGCGGCCCAACCTCCCACCCTTGTCTCTATACACCTGTTGCTTTGGCGGGCCCACCGGGGCCACCCGGTCGCCGGGGGACGTTTGTCCCCGGGCCCGCGCCCGCCGAAGCGCCCTGTGAACCCTGATGAAGATGGACTGTCTGAGTACCATGAAAATTGTCAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGCATTCCGGGGGGCATGCCTGTCCGAGCGTCATTTCTGCCCTCAAGCACGGCTTGTGTGTTGGGTGTGGTCCCTCCGGGGACCTGCCCGAAAGGCAGCGGCGACGTCCGTCTGGTCCTCGAGCGTATGGGGCTCTGTCACTCGCTCGGGAAGGACCTGCGGGGGTTGGTCACCACCATATTTACCACGGTTGACCTCGGATCAGGTAGGAGTTACCCGCTGAACTTAAG


D1D2 region of the 28S ribosomal RNA gene

CATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAATCTGGCCCCTTTGGGGTCCGAGTTGTAATTTGCAGAGGATGCTTCGGGTGCGGTCCCCATCTAAGTGCCCTGGAACGGGCCGTCATAGAGGGTGAGAATCCCGTCTGGGATGGGCGGCCGCGCCCGTGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGCGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGTTGTCCACCAGACTCGCCCGGGGGGGCTCAGCCGGCACGTGTGCCGGTGTACTCCTCTCCGGGCGGGCCAGCATCGGTTTGGGCGGCTGGTGAAAGGCCCCGGGAATGTAACACCCTCCGGGGTGCCTTATAGCCCGGGGTGCCATGCAGCCAGCCTGGACCGAGGCCCGCGCTTCGGCGAGGATGCTGGCGTAATGGTGGTCAACGGC

Morphology Colonies dense on Potato dextrose agar at 25°C after 4-5 days mycelium white, produces red soluble pigment and dark red reverse with greenish-grey sporulating areas. Phialides ampulliform. Conidia globose and smooth walled.
Name of Depositor N Vanittanakom
Special Collection NCRR Contract
Isolation
Soil from a burrow of bamboo rat, Rhizomys sumatrensis, Chiang Mai, Thailand
References

Vanittanakom N, et al. Restriction endonuclease analysis of Penicillium marneffei. J. Clin. Microbiol. 34: 1834-1836, 1996. PubMed: 8784605

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation