Exophiala dermatitidis (Kano) de Hoog, anamorph (ATCC® 201306)

Strain Designations: BMU 3271  /  Product Format: frozen

Strain Designations BMU 3271
Application
Biomedical Research and Development Material
Biosafety Level 2

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Type Strain no
Preceptrol® no
Medium ATCC® Medium 336: Potato dextrose agar (PDA)
Growth Conditions
Temperature: 24.0°C
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal   transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

TGCGGAGGGATCATTAACGAGTTAGGGTCTTCTCAGGCCCGACCTCCCAACCCTTTGTTTACCCGACCCATGTTGCTTCGGCGGGCCCGCCGTTTCGACGGCCGCCGGAGGACCGCCTATTCAGGTCCTCTGGCCCGCGCCCGCCGGTAGCCAATTCTACCAAACTCTTGAATCAAATCGTGTCCAATGTCTGAGTATATTACAAAATAAAAGCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGCGAATTGCAGAATTCCAGTGAGTCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTCGAGCGTCATTATCACCCCTCAAGCCCCCCGGCTTGGTGTTGGACGGTCTGGTCGAGCGTTTCCGCGCGACCCCTCCCAAAGACAATGACGGCGGCCTGGTTGGACCCCCGGTACACGGAGCTTCTTCACTGAGCACGTATCGGTTTCAAGGTGTCCCCGGGACCCGGTCGACCTCTCTTGCTCCCCTGCGGGAGTGGGAGAGAACCCCCCTTTTTATCAAGGTTGACCTCGGATC

Name of Depositor R Li
Special Collection NCRR Contract
Chain of Custody
ATCC <<--R Li<<--Y.N. Li
Isolation
human skin, Zhanjiang, China
References

Ruo-Yu Li, personal communication