Trichophyton simii (Pinoy) Stockdale et al. (ATCC® 16447)

Strain Designations: IMI 101693 [CBS 448.65, NCPF 494]  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Deposited As Arthroderma simii Stockdale et al.
Strain Designations IMI 101693 [CBS 448.65, NCPF 494]
Application
Biomedical Research and Development Material
Biosafety Level 2

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain yes
Preceptrol® no
Mating Type plus
Comments
genetics
Medium ATCC® Medium 28: Emmons' modification of Sabouraud's agar
ATCC® Medium 200: YM agar or YM broth
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAACGCGCAGGCCGGAGGCTGGCCCCCCACGATAGGGCCAAACGTCCATCGGGGGTGAGCAGATGTGCGCCGGCCGTACCGCCCCATTCTTGTCTACCTTACTCGGTTGCCTCGGCGGGCCGCGCTCTCTCCCAGGAGAGCCGTTCGGCGAGCCTCCCTTCAGGGGCTCAACGCTGGACCGCGCCCGCCGGAGGACAGACGCAAAAAAAATTCTTTCAGAAGAGCTGTCAGTCTGAGCGTTAGCAAGCAAAAATCAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCAGCCCCTCAAGCCCGGCTTGTGTGATGGACGACCGTCCGGCGCCCCCTTCTTCGGGGGTGCGGGACGCGCCCGAAAAGCAGTGGCCAGGCCGCGATTCCGGCTTCCTAGGCGAATGGGCAACAAACCAGCGCCTCCAGGACCGGCCGCTCTGGCCTCAGAATCTGTTTCTATACTTATCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAA


D1D2 region of the 28S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAATCTGGCCTCCCCCGGGGGCCCGAGTTGTAATTTGCAGAGGATGCTTCGGGTGCGGCCGCCGTCTAAGTTCCTTGGAACAGGACGTCAGAGAGGGTGAGAATCCCGTCTTGGGCGGGCGGACCGCGCCCGTGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGCGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGGTTAAAAGCACCTTGAAAAGGGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCGGCCAGACTCGGGGGCGGGGTTCAGCGGGTGCTCGTCGCCCGTGTACTCCCCGTCTCCCGGGCCAGCATCAGTTTCGACGGCCGGTCAAAGGCCCCCGGAATGTGTCGTCTCTCGGGACGTCTTATAGCCGGGGGTGCAATGCGGCCCGTCGGGACTGAGGAACGCGCTCCGGCTCGGATGCTGGCGTAATGGCCGTAAGCGGC


beta-tubulin gene

CTAGCTTTCCCCCTGTCCATCACTTCCCCTCTATTTGTGCCCGAAAAACACGACACGGTCTGCACAGGCCAAGAAAGGGGGGGGGGAGGCGAGAGGGCCACCACACGACCACGTCCCAGCGTGAAAGGAACAGGCTTCGAGTTTCACAATTCTCGCATAGCGAGCTTCGAGCATCAGGCTAACGTGCATTTATCGTATAGGTCCATCTCCAAACCGGCCAATGTGTAAGCTTTGATCGTTCCCTGGTTCGTTCTCAGGTACCCGTTTGAGTTAACAATTGTTCGACATTAGGGTAACCAAATTGGTGCTGCTTTCTGGTGAGCATTCACGCGTTGTAGCATAATCGTATATTTCGTGTTGAATCGTTACTGACTTGGTTTACAGGCAAACCATTGCTGGTGAGCACGGTCTCGATGGATCCGGCCAGTGAGTGATTCTGCAGGAAAATAAGTCCAGGCCTCGAGGGACTTGAACGTTGACAACTGGGATTTCTATAGCTACACCGGATCTTCTGACCTCCAATTGGAGCGCATGAATGTCTACTTCAACGAGGTGTGCACGACCAAGACCCTTCCCTTCAGCAGCATACTAACTCATTGGAGGCAAAGGCCTCAAGCAAAAAATACGTTCCCCGTGCGGTTCTTGTTGATCTTGAGCCCGCCGCTCTCGATGCTGTCCGTGCCGGTCCTTTCGGTCAGCTCTTCCGCCCCGATAACGTCGTCTTCGGTCAGTCTGGTGCCGGAAACAACTGG

Name of Depositor IMI
Chain of Custody
ATCC <-- IMI <-- C.M. Singh
Isolation
Chicken, India; monascospore isolate
Cross References

Nucleotide (GenBank) : KJ606091 ITS including 5.8S rRNA gene

Nucleotide (GenBank) : KJ606139 D1/D2 region of 28S rRNA gene

Nucleotide (GenBank) : KJ606187 beta-tubulin gene

References

Stockdale PM, et al. Arthroderma simii sp. nov., the perfect state of Trichophyton simii (Pinoy) comb. nov.. Sabouraudia 4: 112-123, 1965. PubMed: 5874151

Desvignes A, et al. Genetic analysis in a dermatophyte fungus: Arthroderma simii. Ann. Inst. Pasteur 122: 943-950, 1972. PubMed: 5050881

de Hoog GS, et al. Toward a novel multilocus phylogenetic taxonomy for the dermatophytes. Mycopathologia 182: 5-31, 2017. PubMed: 27783317

Beguin H, et al. The taxonomic status of Trichophyton quinckeanum and T. interdigitale revisited: a multigene phylogenetic approach. Med Mycol 50: 871-882, 2012. PubMed: 22587727

Kano R, et al. Mating genes of the Trichophyton mentagrophytes complex. Mycopathologia 173: 103-112, 2012. PubMed: 22057847

Kawasaki M, et al. Different genes can result in different phylogenetic relationships in Trichophyton species. Nippon Ishinkin Gakkai Zasshi 49: 311-318, 2008.

Campbell CK, et al. Arthroderma olidum, sp. nov. A new addition to the Trichophyton terrestre complex. Med Mycol 44: 451-459, 2006. PubMed: 16882612

Sugiyama, M, Summerbell, R C, Mikawa, T. Molecular phylogeny of onygenalean fungi based on small subunit (SSU) and large subunit (LSU) ribosomal DNA sequences. Stud Mycol 47: 5-23, 2002.

Graser Y, et al. Phylogeny and taxonomy of the family Arthrodermataceae (dermatophytes) using sequence analysis of the ribosomal ITS region. Med Mycol 37: 105-114, 1999. PubMed: 10361266

Summerbell RC, et al. rRNA gene internal transcribed spacer 1 and 2 sequences of asexual, anthropophilic dermatophytes related to Trichophyton rubrum. J. Clin. Microbiol. 37: 4005-4011, 1999. PubMed: 10565922

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • USDA APHIS VS 16-6 or 16-6A permit must be obtained and a copy of the permit must be sent to ATCC in advance of shipment. The Application Form VS 16-3 (Import controlled material import or transport organisms or vectors) must be submitted to USDA APHIS Veterinary Services to obtain the VS 16-6 or 16-6A permit.
  • Customer Acceptance of Responsibility, ATCC Form 62 required for distribution.
  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation