Aspergillus fumigatus Fresenius, anamorph (ATCC® 13073)

Strain Designations: 5233 [NIH 5233]  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Strain Designations 5233 [NIH 5233]
Application
produces antigens
Biomedical Research and Development Material
Emerging infectious disease research
Opportunistic pathogen research
Respiratory research
Biosafety Level 2
Product Format freeze-dried
Type Strain no
Preceptrol® no
Comments
Toxic to human cancer cell lines
Morphology After 7-10 days on MEA at 25°C mycelium white; reverse uncolored, yellowish, red brown or green.  Conidia grayish turquoise to dull green. Conidial heads predominantly columnar; stipes uncolored, smooth-walled.  Conidia globose to broadly ovoid, smoothly to finely roughened.
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

TCCGTAGGTGAACCTGCGGAAGGATCATTACCGAGTGAGGGCCCTCTGGGTCCAACCTCCCACCCGTGTCTATCGTACCTTGTTGCTTCGGCGGGCCCGCCGTTTCGACGGCCGCCGGGGAGGCCTTGCGCCCCCGGGCCCGCGCCCGCCGAAGACCCCAACATGAACGCTGTTCTGAAAGTATGCAGTCTGAGTTGATTATCGTAATCAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCCCCCGTCCCCCTCTCCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCTGCTCTGTAGGCCCGGCCGGCGCCAGCCGACACCCAACTTTATTTTTCTAAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAG

Morphology After 7-10 days on MEA at 25°C mycelium white; reverse uncolored, yellowish, red brown or green.  Conidia grayish turquoise to dull green. Conidial heads predominantly columnar; stipes uncolored, smooth-walled.  Conidia globose to broadly ovoid, smoothly to finely roughened.
Name of Depositor HF Hasenclever
Isolation
human pulmonary lesion, Maryland
Cross References

Nucleotide (GenBank) : AY040608 Plasma membrane H+-ATPase (PMA1) gene, complete coding sequence.

Nucleotide (GenBank) : AY040609 Plasma membrane H+-ATPase (PMA1) gene, mRNA, complete coding sequence.

Nucleotide (GenBank) : KC689314 ITS including 5.8S rRNA gene

References

Kim SJ, Chaparas SD. Characterization of antigens from Aspergillus fumigatus. I. Preparation of antigens from organisms grown in completely synthetic medium. Am. Rev. Respir. Dis. 118: 547-560, 1978. PubMed: 101103

Daly P, et al. Culture filtrates of Aspergillus fumigatus induce different modes of cell death in human cancer cell lines. Mycopathologia 146: 67-74, 1999.

Burghoorn HP, et al. Molecular evaluation of the plasma membrane proton pump from Aspergillus fumigatus. Antimicrob. Agents Chemother. 46: 615-624, 2002. PubMed: 11850239

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation