Rhizopus oryzae Went et Prinsen Geerligs (ATCC® 9363)

Strain Designations: NRRL 395 [IMI 40564]  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Strain Designations NRRL 395 [IMI 40564]
Application
Degrades barley
Degrades cassava
Degrades corn
Degrades rice
Degrades sugarcane bagasse
Produces L(+)-lactic acid
Produces NAD-dependent lactate dehydrogenase
Produces amylase
Produces chitosan
Produces ergostadientriols
Produces fumaric acid
Produces lactic acid lactate
Produces ergostadientriols useful in lowering serum cholesterol levels
Produces L(+)-lactic acid from ground corn
Produces L(+)-lactic acid from barley, cassava, corn, oats and rice
Produces L(+)-lactic acid in calcium alginate gels
Produces L(+)-lactic acid from sugarcane bagasse
Produces amylolytic enzymes
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Comments
Source of lactate dehydrogenase genes used in the construction of expression vectors
Tempeh fermentation
Medium ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 323: Malt agar medium
ATCC® Medium 336: Potato dextrose agar (PDA)
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAATTATGTTAAAGCGCCTTACCTTAGGGTTTCCTCTGGGGTAAGTGATTGCTTCTACACTGTGAAAATTTGGCTGAGAGACTCAGACTGGTCATGGGTAGACCTATCTGGGGTTTGATCGATGCCACTCCTGGTTTCAGGAGTACCCTTCATAATAAACCTAGAAATTCAGTATTATAAAGTTTAATAAAAAACAACTTTTAACAATGGATCTCTTGGTTCTCGCATCGATGAAGAACGTAGCAAAGTGCGATAACTAGTGTGAATTGCATATTCAGTGAATCATCGAGTCTTTGAACGCAGCTTGCACTCTATGGTTTTTCTATAGAGTACGCCTGCTTCAGTATCATCACAAACCCACACATAACATTTGTTTATGTGGTGATGGGTCGCATCGCTGTTTTATTACAGTGAGCACCTAAAATGTGTGTGATTTTCTGTCTGGCTTGCTAGGCAGGAATATTACGCTGGTCTCAGGATCTTTTTTTTTGGTTCGCCCAGGAAGTAAAGTACAAGAGTATAATCCAGTAACTTTCAAACTATGATCTGAAGTCAGGTGGGATTACCCGCTGAACTTAAGCATATCAATAA


D1D2 region of the 28S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAAATAACAATGATTTCCCTAGTAACGGCGAGTGAAGAGGAAAGAGCTCAAAGTTGGAACCTGTTTGGCCTAGCTAAACCGGATTGTAGACTGTAGAAGTGTTTTCCAGGCAAGCCGAGTAAATAAGTCCTTTGGAACAGGGCATCATAGAGGGTGAGAATCCCGTCTTTGGCTTGAGCATTTGCCTTTTGTGATACGCTTTCAAAGAGTCAGGTTGTTTGGGAATGCAGCCTAAATTGGGTGGTAAATCTCACCTAAAGCTAAATATTGGCGAGAAACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAACAGTATGTGAAATTGTTAAAAGGGAACCGTTTGGAGCCAGACTGGCTTGTCTGTAATCAATCTAGGCTTCGGCCTGGATGCACTTGCAGGCTATGCCTGCCAACGACAATTTGACTTGAGGGAAAAAACTAGGGGAAATGTGGCCCACTTGTGGGTGTTATAGTCCCTTAGAAAATACCTTGGGTTGGATTGAGGAACGCAGCGAATGCTTATTGGCGAGTTTTCCAGGAAGGTTTTCTGAGGTACTACGGTATCAAGGTTGATCTTTTTGGTTATACTTCTATTCGCTTAGGTTGTTGGCTTAATGACTCTAAATGAC

Name of Depositor NRRL
Isolation
Source of lactate dehydrogenase genes used in the construction of expression vectors
Cross References

Nucleotide (GenBank) : AF226154 lactate dehydrogenase (ldhA) gene, complete coding sequence

Nucleotide (GenBank) : AF226155 lactate dehydrogenase (ldhB) gene, complete coding sequence

References

Goldberg I, Stieglitz B. Improved rate of fumaric acid production by Tweens and vegetable oils in Rhizopus arrhizus. Biotechnol. Bioeng. 27: 1067-1069, 1985.

Zilliken FW. Ergostadienetriols, compositions containing same, and methods of preparing and using same. US Patent 4,234,577 dated Nov 18 1980

Soccol CR, et al. Potential of solid state fermentation for production of L(+)-lactic acid by Rhizopus oryzae. Appl Microbiol Biotechnol 41: 286-290, 1994.

Yu RC, Hang YD. Purification and characterization of NAD-dependent lactate dehydrogenase from Rhizopus oryzae. Food Chem. 41: 219-225, 1991.

Skory CD. Isolation and expression of lactate dehydrogenase genes from Rhizopus oryzae. Appl. Environ. Microbiol. 66: 2343-2348, 2000. PubMed: 10831409

Skory CD. Fungal lactate dehydrogenase gene and constructs for the expression thereof. US Patent 6,368,189 dated Jul 31 2001

Hang YD. Direct fermentation of corn to L(+)-lactic acid by Rhizopus oryzae. Biotechnol. Lett. 11: 299-300, 1989.

Hang YD, et al. Production of L(+)-lactic acid by Rhizopus oryzae immobilized in calcium alginate gels. Biotechnol. Lett. 11: 119-120, 1989.

Yu RC, Hang YD. Kinetics of direct fermentation of agricultural commodities to L(+)-lactic acid by Rhizopus oryzae. Biotechnol. Lett. 11: 597-600, 1989.

Yu RC, Hang YD. Amylolytic enzyme production by Rhizopus oryzae grown on agricultural commodities. World J. Microbiol. Biotechnol. 6: 15-18, 1990.

Hang YD. Chitosan production from Rhizopus oryzae mycelia. Biotechnol. Lett. 12: 911-912, 1990.

Soccol CR, et al. Production of L-lactic acid by Rhizopus species. World J. Microbiol. Biotechnol. 10: 433-435, 1994.

Pritchard GG. Factors affecting the activity and synthesis of NAD-dependent lactate dehydrogenase in Rhizopus oryzae. J. Gen. Microbiol. 78: 125-137, 1973.

Ward GE, et al. Biochemical studies in the genus Rhizopus. I. The production of dextro-lactic acid. J. Am. Chem. Soc. 58: 1286-1288, 1936.

Gryganskyi AP, et al. Structure, function, and phylogeny of the mating locus in the Rhizopus oryzae complex. PLoS One 5: e15273, 2010. PubMed: 21151560

Skory CD, et al. Analysis of a functional lactate permease in the fungus Rhizopus. Enzyme Microb Technol 46: 43-50, 2010.

Mertens JA, Skory CD. Isolation and characterization of a second glucoamylase gene without a starch binding domain from Rhizopus oryzae. Enzyme Microb Technol 40: 874-880, 2007.

Mertens JA, Skory CD, Ibrahim AS. Plasmids for expression of heterologous proteins in Rhizopus oryzae. Arch Microbiol 186: 41-50, 2006. PubMed: 16804680

Saito K, et al. Genetic diversity in Rhizopus oryzae strains as revealed by the sequence of lactate dehydrogenase genes. Arch Microbiol 182: 30-36, 2004. PubMed: 15278242

Abe A, et al. rDNA ITS sequence of Rhizopus oryzae: its application to classification and identification of lactic acid producers. Biosci Biotechnol Biochem 67: 1725-1731, 2003. PubMed: 12951506

Skory CD. Induction of Rhizopus oryzae pyruvate decarboxylase genes. Curr Microbiol 47: 59-64, 2003. PubMed: 12783195

Skory CD. Homologous recombination and double-strand break repair in the transformation of Rhizopus oryzae. Mol Genet Genomics 268: 397-406, 2002. PubMed: 12436261

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation