Aspergillus fijiensis Varga et al. (ATCC® 20611)

Strain Designations: ACE-2-1  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Deposited As Aspergillus niger van Tieghem
Strain Designations ACE-2-1
Application
produces inulosucrase fructosyl transferase
produces pyridoxine derivatives
produces a fructooligosaccharide-producing beta-fructofuranosidase
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Disclosure This material is cited in a US or other Patent and may not be used to infringe the claims. Depending on the wishes of the Depositor, ATCC may be required to inform the Patent Depositor of the party to which the material was furnished. This material may not have been produced or characterized by ATCC.
Preceptrol® no
Comments The strain was re-identified based on multigene sequence analyses.
Medium ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 336: Potato dextrose agar (PDA)
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACCGAGTGCTGGGTCCTTCGGGGCCCAACCTCCCACCCGTGCTTACCGTACCCTGTTGCTTCGGCGGGCCCGCCTTCGGGCGGCCCGGGGCCTGCCCCCGGGACCGCGCCCGCCGGAGACCCCAATGGAACACTGTCTGAAAGCGTGCAGTCTGAGTCGATTGATACCAATCAGTCAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTTCTCCCCTCCAGCCCCGCTGGTTGTTGGGCCGCGCCCCCCCGGGGGCGGGCCTCGAGAGAAACGGCGGCACCGTCCGGTCCTCGAGCGTATGGGGCTCTGTCACCCGCTCTATGGGCCCGGCCGGGGCTTGCCTCGACCCCCAATCTTCTCAGATTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAA


D1D2 region of the 28S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAAGCTGGCCCCTCCGGGGTCCGCGTTGTAATTTGCAGAGGATGCTTTGGGTGCGGCCCCCGTCTAAGTGCCCTGGAACGGGCCGTCAGAGAGGGTGAGAATCCCGTCTTGGGCGGGGTGTCCGTGCCCGTGTAAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGACTCGCCCTCGGGGTTCAGCCGGCACTCGTGCCGGTGTACTTCCCCGGGGGCGGGCCAGCGTCAGCTTGGGCGGCCGGTCAAAGGCCTCCGGAATGTAGTGCCCCCCGGGGCACCTTATAGCCGGAGGTGCAATGCGGCCAGCCTGGGCTGAGGAACGCGCTTCGGCACGGACGCTGGCATAATGGTCGCAAACGAC


Calmodulin gene

TTTTTGTAAGCGACCCCGATGCTTTCTCGTCTGCTATAAAACAATGTTTACTGATTCGTTTCTCGTGATCCCTGATAGGACAAGGATGGCGATGGTTAGTGTAGTTCTTTACCCCTCAACGAAACCCGCCTGGCATCACCTGGCACTATAGCCACCATACCGCAAACGCCACAGAAACTATCAAGAATCGATCGCATTTCTGACAGAATCCATGCTACAGGACAAATTACCACCAAGGAGTTGGGTACCGTTATGCGCTCTCTCGGCCAGAACCCCTCCGAGTCTGAGCTCCAGGACATGATCAACGAGGTTGACGCTGACAACAACGGCACTATCGACTTTCCCGGTATGTGATGGCCATGCATCGAGCTCCGGACATAGTATTGACAGCTGCCCAGAATTCCTTA

Name of Depositor Meiji Seika Kaisha, Ltd.
U.S. Patent Number
U.S. Patent
Disclosure This material is cited in a US or other Patent and may not be used to infringe the claims. Depending on the wishes of the Depositor, ATCC may be required to inform the Patent Depositor of the party to which the material was furnished. This material may not have been produced or characterized by ATCC.
Cross References

Nucleotide (GenBank) : KU729079 ITS including 5.8S rRNA gene

Nucleotide (GenBank) : KU729176 D1/D2 region of 28S rRNA gene

Nucleotide (GenBank) : KU933404 calmodulin gene

References

Suzuki Y, Uchida K. Formation of beta-fructosyl compounds of pyridoxine in growing culture of Aspergillus niger. Biosci. Biotechnol. Biochem. 57: 875-880, 1993. PubMed: 7763873

Kono T, et al. Fructose transferring enzyme absorbed on a granular carrier for production of fructooligosaccharides. US Patent 5,314,810 dated May 24 1994

Adachi T, Hidaka H. Sweetener. US Patent 4,681,771 dated Jul 21 1987

Hidaka H, et al. A fructooligosaccharide-producing enzyme from Aspergillus niger ATCC 20611. Agric. Biol. Chem. 52: 1181-1187, 1988.

Hirayama M, et al. Purification and properties of a fructooligosaccharide-producing beta-fructofuranosidase from Aspergillus niger ATCC 20611. Agric. Biol. Chem. 53: 667-673, 1989.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation