Zygosaccharomyces bailii (Lindner) Guilliermond, teleomorph (ATCC® 42476)

Strain Designations: 922  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Deposited As Saccharomyces bailii var. bailii Lindner, teleomorph
Strain Designations 922
Application
Production of sherry type wine
Biosafety Level 1
Product Format freeze-dried
Type Strain no
Preceptrol® no
Medium ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 1245: YEPD
ATCC® Medium 28: Emmons' modification of Sabouraud's agar
Growth Conditions
Temperature: 20°C to 25°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

TTTCCGTAGGTGAACCTGCGGAAGGATCATTATAGAAAATTTCTGATTGACGAGTCTGGAGTAGTTGTGTTCTCTCTGTTTTTTCAAGGCCTGCGCTTAATTGCGCGGTCTAGAGCGGAGGGAGTTAAACATAGTTACTCTGGCTTTCAATTTACACACAGTGGAGTTTCTACTTTTTTTATTCTTCTTTGGGAGGATGGGTTCGTCCCACTCCCAGAGGTAAAAACACAAACAATTTTTTTTTTTTTTTTTAATATTACACAGTCAAAAACGAATACTAAAAAACAAAATATTCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCAGGGGGCATGCCTGTTTGAGCGTCATTTCCTTCTCAAACATTCGTGTTTGGTAGTGAGTGATACTCTGTTTTTCATTTGGGTTAACTTGAAATTGCAAGCCTTTTGGGGAACGCGTGTGGGTGAGTTTTAGGCGGAAACGTCTTGCTCTCCTCTTTCCTAACCAAATGTCGTATTAGGTTTTACCGACTCCGACAGACGGGACTAGGAGATTGGGTGAGTGATAGCAATATCGAGCTCTGCCTAATTTTTTTTTTGCGCGCCTTGGGCAAACAATACTCTCAAAGTTTGACCTCAAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAA


D1D2 region of the 26S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGTACCTTCGGTGCCCGAGTTGTAATTTGTAGAAGGCGACTCTGGGGCTGGTCCTTGTCTATGTTCCTTGGAACAGGAAGTCATGGAGGGTGAGAATCCCGTATGGCGAGGATCCCAGTTCTTTGTAGAGTGCCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGTGTTTTGCGCCCCTCGCCTCTCGTGGGTGGGGGAATCTCGCAGTTCACTGGGCCAGCATCAGTTTTGGCGGCAGGATAAATCCCTGGGAATGTAGCTCTACCACTTCGTGGCGGACGAACTTATAGTCCAGGGGAATACTGCCAGCTGGGACTGAGGAATGCGACTTTTAGTCAAGGATGCTGGCATAATGGTTATATGCCGC

Name of Depositor GA Farris
Cross References

Nucleotide (GenBank) : JX458102 ITS including 5.8S rRNA gene

Nucleotide (GenBank) : JX458121 D1/D2 region of 26S rRNA gene

Nucleotide (GenBank) : KC678098 RNA polymerase II largest subunit (RPB1) gene

Nucleotide (GenBank) : KC678070 polymerase II second largest subunit (RPB2) gene

References

Suh SO, et al. Proposal of Zygosaccharomyces parabailii sp. nov. and Zygosaccharomyces pseudobailii sp. nov., two new species closely related to Zygosaccharomyces bailii. Int. J. Syst. Evol. Microbiol. 63: 1922-1929, 2013. PubMed: 23524351

Ann. Microbiol. 26:55, 1976.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation