Trichosporon oleaginosus Zhou et al. (ATCC® 20508)

Strain Designations: R  /  Product Format: freeze-dried

Deposited As Candida curvata
Strain Designations R
Application
Biodiesel production
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Type Strain no
Preceptrol® no
Comments
alkali-tolerant at pH 10
Sequenced Data
Trichosporon oleaginosus ATCC 20508 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

GTTTCCGTAGGTGAACCTGCGGAAGGATCATTAGTGAATTGCTCTTTGAGCGTTAACTACATCCATCTACATCTGTGAACTGTTGATTGACTTCGGTCAATAACTTTTACAAACACTGTGTAATGAACGTCATGTTATTATAACAAAAATAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCAACTTGCGCTCTCTGGTATTCCGGAGAGCATGCCTGTTTGAGTATCATGAAATCTCAACCATTAGGGTTTCTTAATGGCTTGGAATTGGGCGCTGCCACTTGCCTGGCTCGCCTTAAAAGAGTTAGCGTGTTAAACTTGTCGTAAACTGGCGTAATAAGTTTCGCTGGTGGTAGACTTGTGAAGGACGCTTCTAATCGTCTTCGGACACTTCTTGAACTCTGGTCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCTTAGTAACGGCGAGTGAACCGGGAAAAGCTCAAATTTGTAATCTGGCTGTCTTCGATAGTCCGAGTTGTAATCTATAGACGTGTTTTCCGTGCTGGACCGTATCTAAGTCCCTTGGAACAGGGTATCAAAGAGGGTGACAATCCCGTGCTTGATACGACCACCAGTGCTCTGTGATACACGTTCTACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGATTGAAGTCAGTCGTGTTCTTCAGATTCAGCTGGTTCTTCCAGTCTACTTCTGTGGAACGGGTCAACATCAGTTTTGTCCGGTGGATAAAGGTAGTAGGAATGTGACTCCCCCGGGAGTGTTATAGCCTATTATTGCATACACTGGGTGAGACTGAGGACTGCAGCTCGCCTTTTGGCCGGTCTTCGGACACGTTCGAGCTTAGGATGTTGACATAATGGCTTTAAACGAC

Name of Depositor Iowa State Univ. Res. Fndn.
U.S. Patent Number
Disclosure This material is cited in a US or other Patent and may not be used to infringe the claims. Depending on the wishes of the Depositor, ATCC may be required to inform the Patent Depositor of the party to which the material was furnished.
Chain of Custody
ATCC <-- Iowa State Univ. Res. Fndn. <-- NJ Moon
Isolation
dairy plant
References

Moon NJ, Hammond EG. Process for converting whey permeate to oil-containing yeast. US Patent 4,235,933 dated Nov 25 1980

Lognay G, et al. Sterol composition of Candida curvata yeast. Biotechnol. Lett. 9: 467-470, 1987.

Aono R. Taxonomic distribution of alkali-tolerant yeasts. Syst. Appl. Microbiol. 13: 394-397, 1990.

Gujjari P, et al. Characterization of oleaginous yeasts revealed two novel species: Trichosporon cacaoliposimilis sp. nov. and Trichosporon oleaginosus sp. nov. Mycologia. 103:1110-1118, 2011. PubMed: 21558504

Thiru M, Sankh S, Rangaswamy V. Process for biodiesel production from Cryptococcus curvatus. Bioresour. Technol. 102: 10436-10440, 2011. PubMed: 21930373