Isaria fumosorosea Wize (ATCC® MYA-4887)

Strain Designations: ARSEF 2679  /  Product Format: frozen

Strain Designations ARSEF 2679
Biosafety Level 1
Product Format frozen
Type Strain no
Preceptrol® no
Genome Sequenced Strain

Yes

Comments
Insect pathogenic fungi
Genome sequencing strain (Shanghai Institutes for Biological Sciences, CAC, China)
Morphology On YM medium at 25°C after 13 days, mycelium white to dingy white, dense, slightly raised forming a mound, velvety. Conidia ellipsoidal to broadly fusiform, smooth, 4-5 µm X 2-3 µm.
Medium ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 336: Potato dextrose agar (PDA)
Growth Conditions
Temperature: 20°C to 25°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal   transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence; GenBank number JQ906773:

TCCGTTGGTGAACCAGCGGAGGGATCATTACCAGAGTTTTCACAACTCCCAACCCTCCTGTGAACCTACCCATCGTTGCTTCGGCGGACTCGCCCCAGCGTCCGGACGGCCTCGCGCCGGCCCGCGACCTGGACCCAGGCGGCCGCCGGAGACCACGCAACCCTGCATCCATCAGTCTCTCTGAATCCGCCGCAAGGCAACACAAACGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCGACGTCCCCCGGGACGTCGGCCTTGGGGACCGGCAGCACCCCGCCGGCCCTGAAATGGAGTGGCGGCCCGTCCGCGGCGACCTCTGCGAAGTACTACAGCTCGCACCGGAAACCCGACGCGGCCCCGCCGTGAAACCCCCAACTCTGAACGTTGACCTCGGATCAGGTAGGA-CTACCCGCTGAACTTAAG

 

D1D2 region of the 28S ribosomal RNA gene; GenBank number JQ906768:

ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCCCGGGTCCGAGTTGTAATTTGCAGAGGATGCTTCGGGCGAGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGTCGGACACCGAGCCCGTGTGAAGCTCCTTCGAAGAGTCGAGTAGTTTGGGAATGCTGCTCAAAACGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCCCATGACCAGACTTGGGCCCGGTGAATCACCCGGCGTTCTCGCCGGTGCACTTTGCCGGGCACAGGCCAGCATCAGTTTGGCGCGGGGGAGAAAGGCTTCGGGAACGTGGCTCCCTCGGGAGTGTTATAGCCCGCTGCGCAATACCCTGCGCCGGACTGAGGTACGCGCATCGCAAGGATGCTGGCGTAATGGTCATCAGCGA

Morphology On YM medium at 25°C after 13 days, mycelium white to dingy white, dense, slightly raised forming a mound, velvety. Conidia ellipsoidal to broadly fusiform, smooth, 4-5 µm X 2-3 µm.
Name of Depositor RA Humber
Special Collection ATCC
Chain of Custody
ATCC <-- RA Humber <--AS Martins
Isolation
Popillia japonica (Coleoptera: Scarabaeidae), Terceira Island, Azores, Portugal.
Cross References

Nucleotide (GenBank) : JQ906773 ITS including 5.8S rRNA gene

Nucleotide (GenBank) : JQ906768 D1/D2 region of 28S rRNA gene