Nectria haematococca Berkeley et Broome, teleomorph (ATCC^® MYA-4622^™)

Strain Designations: FGSC 9596 [mpVI 77-13-4] / Product Format: frozen

Nectria haematococca Berkeley et Broome, teleomorph ATCC^® MYA-4622^™

frozen

For-Profit: $354.00 Non-Profit: $294.99

Qty:

Permits and Restrictions	View Permits
Strain Designations	FGSC 9596 [mpVI 77-13-4]
Biosafety Level	1 Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.
Product Format	frozen
Type Strain	no

Preceptrol®	no
Genome Sequenced Strain	Yes
Comments	Genome sequencing strain (the Joint Genome Institute at the Department of Energy, USA). Plant pathogen.

Medium	ATCC^® Medium 336: Potato dextrose agar (PDA) ATCC^® Medium 324: Malt extract agar
Growth Conditions	Temperature: 25.0°C

Sequenced Data	>ITS of MYA-4622 GTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTATTCAACTCATCAACCCTGTGAACATACCTAAACGTTGCTTCGGCGGGAACAGACGGCCCCGTGAAACGGGCCGCCCCCGCCAGAGGACCCCTAACTCTGTTTCTATAATGTTTCTTCTGAGTAAAACAAGCAAATAAATTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTACAACCCTCAGGCCCCCGGGCCTGGCGTTGGGGATCGGCGGAGCCCCCCGTGGGCACACGCCGTCCCCCAAATGCAGTGGCGGTCCCGCCGCAGCTTCCATCGCGTAGTAGCTAACACCTCGCGACTGGAGAGCGGCGCGGCCACGCCGTAAAACACCCAACTCTTCTGAAGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAA //

Sequenced Data

>ITS of MYA-4622

GTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTATTCAACTCATCAACCCTGTGAACATACCTAAACGTTGCTTCGGCGGGAACAGACGGCCCCGTGAAACGGGCCGCCCCCGCCAGAGGACCCCTAACTCTGTTTCTATAATGTTTCTTCTGAGTAAAACAAGCAAATAAATTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTACAACCCTCAGGCCCCCGGGCCTGGCGTTGGGGATCGGCGGAGCCCCCCGTGGGCACACGCCGTCCCCCAAATGCAGTGGCGGTCCCGCCGCAGCTTCCATCGCGTAGTAGCTAACACCTCGCGACTGGAGAGCGGCGCGGCCACGCCGTAAAACACCCAACTCTTCTGAAGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAA

Name of Depositor	FGSC
Special Collection	ATCC
Chain of Custody	ATCC <-- FGSC
Cross References	Nucleotide (GenBank) : GU327638 ITS including 5.8S rRNA gene
References	Coleman JJ, et al. The genome of Nectria haematococca: contribution of supernumerary chromosomes to gene expansion. PLoS Genet 5: e1000618, 2009.

Permits	These permits may be required for shipping this product: USDA APHIS PPQ Permit 526, plant pathogens permit must be obtained and a copy of the permit must be sent to ATCC in advance of shipment. Isolation information for this item is required by USDA. Please check our website or contact Technical Service for assistance. Domestic isolates are easier to obtain than foreign isolates. Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation	Product Sheet Certificate of Analysis SDS

Permits

These permits may be required for shipping this product:

USDA APHIS PPQ Permit 526, plant pathogens permit must be obtained and a copy of the permit must be sent to ATCC in advance of shipment. Isolation information for this item is required by USDA. Please check our website or contact Technical Service for assistance. Domestic isolates are easier to obtain than foreign isolates.
Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.

Basic Documentation