Nectria haematococca Berkeley et Broome, teleomorph (ATCC® MYA-4622™) Strain Designations: FGSC 9596 [mpVI 77-13-4] / Product Format: frozen General Information Characteristics Culture Method Specifications History Documentation Print Email Share Share this product Facebook Twitter Google+ Permits and Restrictions View Permits Strain Designations FGSC 9596 [mpVI 77-13-4] Biosafety Level 1 Product Format frozen Type Strain no Preceptrol® no Genome Sequenced Strain Yes Comments Genome sequencing strain (the Joint Genome Institute at the Department of Energy, USA).Plant pathogen. Medium ATCC® Medium 336: Potato dextrose agar (PDA) ATCC® Medium 324: Malt extract agar Growth Conditions Temperature: 25.0°C Sequenced Data >ITS of MYA-4622GTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTATTCAACTCATCAACCCTGTGAACATACCTAAACGTTGCTTCGGCGGGAACAGACGGCCCCGTGAAACGGGCCGCCCCCGCCAGAGGACCCCTAACTCTGTTTCTATAATGTTTCTTCTGAGTAAAACAAGCAAATAAATTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTACAACCCTCAGGCCCCCGGGCCTGGCGTTGGGGATCGGCGGAGCCCCCCGTGGGCACACGCCGTCCCCCAAATGCAGTGGCGGTCCCGCCGCAGCTTCCATCGCGTAGTAGCTAACACCTCGCGACTGGAGAGCGGCGCGGCCACGCCGTAAAACACCCAACTCTTCTGAAGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAA// Name of Depositor FGSC Special Collection ATCC Chain of Custody ATCC <-- FGSC Cross References Nucleotide (GenBank) : GU327638 ITS including 5.8S rRNA gene References Coleman JJ, et al. The genome of Nectria haematococca: contribution of supernumerary chromosomes to gene expansion. PLoS Genet 5: e1000618, 2009. Permits These permits may be required for shipping this product: Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment. USDA APHIS PPQ Permit 526, plant pathogens permit must be obtained and a copy of the permit must be sent to ATCC in advance of shipment. Isolation information for this item is required by USDA. Please check our website or contact Technical Service for assistance. Domestic isolates are easier to obtain than foreign isolates. Basic Documentation Product Sheet Certificate of Analysis MSDS