Nectria haematococca Berkeley et Broome, teleomorph (ATCC® MYA-4622™) Strain Designations: FGSC 9596 [mpVI 77-13-4] / Product Format: frozen General Information Characteristics Culture Method Specifications History Documentation Print Email Share Share this product Facebook Twitter Google+ Strain Designations FGSC 9596 [mpVI 77-13-4] Biosafety Level 1 Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. Product Format frozen Type Strain no Preceptrol® no Genome Sequenced Strain Yes Comments Genome sequencing strain (the Joint Genome Institute at the Department of Energy, USA).Plant pathogen. Medium ATCC® Medium 336: Potato dextrose agar (PDA) ATCC® Medium 324: Malt extract agar Growth Conditions Temperature: 25.0°C Sequenced Data >ITS of MYA-4622GTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTATTCAACTCATCAACCCTGTGAACATACCTAAACGTTGCTTCGGCGGGAACAGACGGCCCCGTGAAACGGGCCGCCCCCGCCAGAGGACCCCTAACTCTGTTTCTATAATGTTTCTTCTGAGTAAAACAAGCAAATAAATTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTACAACCCTCAGGCCCCCGGGCCTGGCGTTGGGGATCGGCGGAGCCCCCCGTGGGCACACGCCGTCCCCCAAATGCAGTGGCGGTCCCGCCGCAGCTTCCATCGCGTAGTAGCTAACACCTCGCGACTGGAGAGCGGCGCGGCCACGCCGTAAAACACCCAACTCTTCTGAAGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAA// Name of Depositor FGSC Special Collection ATCC Chain of Custody ATCC <-- FGSC Cross References Nucleotide (GenBank) : GU327638 ITS including 5.8S rRNA gene References Coleman JJ, et al. The genome of Nectria haematococca: contribution of supernumerary chromosomes to gene expansion. PLoS Genet 5: e1000618, 2009. Basic Documentation Product Sheet Certificate of Analysis SDS