Candida tenuis Diddens et Lodder (ATCC® 10573)

Strain Designations: NRRL Y-1498 [CBS 615, CCRC 21748, DBVPG 6159, IFO 10315, VKM Y-70]  /  Product Format: frozen

Permits and Restrictions

View Permits

Deposited As Candida tenuis Diddens et Lodder
Strain Designations NRRL Y-1498 [CBS 615, CCRC 21748, DBVPG 6159, IFO 10315, VKM Y-70]
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain yes
Preceptrol® no
Genome Sequenced Strain

Yes

Comments
Genome sequencing strain (the Joint Genome Institute at the Department of Energy, USA; Wellcome Trust Sanger Institute, UK).
Sequenced Data
26S ribosomal RNA gene, partial sequence.

ACCAACAGGGATTGCCTTAGTAGCGGCGAGTGAAGCGGCAATAGCTCAAATTTGAAATCTGGCGTCTTCGACGTCCGAGTTGTAATTTGAAGAAGGTATCTTTGGAATTGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGCCCAATTCCGTGTAAAGTTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACTGTGAAGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCTTGAGGTCAGACTTGGTTTTACCAGGCCAGCATCAGTTTGGACGGCAGGATAATAGCTAAGAAATGTGACTCCACCTCGGTGGTGTGTTATAGTCTTGGTTGATACTGCCTGTCTAGACTGAGGACTGCGTCTTTGACTAGGATGCT

Name of Depositor NRRL
Chain of Custody
ATCC <-- NRRL <-- CBS 615 <-- E.C. Holst
Isolation
Bark-beetle, USA
Cross References

Nucleotide (GenBank) : AEIM00000000 Candida tenuis ATCC 10573, whole genome shotgun sequencing project

References

Groenewald M, Robert V, Smith MT. The value of the D1/D2 and internal transcribed spacers (ITS) domains for the identification of yeast species belonging to the genus Yamadazyma. Persoonia 26: 40-46, 2011. PubMed: 22025802

Wohlbach DJ, et al. Comparative genomics of xylose-fermenting fungi for enhanced biofuel production. Proc. Natl. Acad. Sci. USA 108: 13212-13217, 2011. PubMed: 21788494

Sugita T, Nakase T. Non-universal usage of the leucine CUG codon and the molecular phylogeny of the genus Candida. Syst Appl Microbiol 22: 79-86, 1999. PubMed: 10188281

Suzuki M, Nakase T. Cellular neutral sugar compositions and ubiquinone systems of the genus Candida. Microbiol. Cult. Collect. 14: 49-62, 1998.

Kurtzman CP, Robnett CJ. Identification of clinically important ascomycetous yeasts based on nucleotide divergence in the 5' end of the large-subunit (26S) ribosomal DNA gene. J Clin Microbiol 35: 1216-1223, 1997. PubMed: 9114410

Diddens HA, Lodder J. Die anaskosporogenen Hefen, zweite Halfte. Amsterdam: North-Holland; 1942.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation