Advanced Search

Aspergillus clavatus Desmazieres, anamorph (ATCC® 1007™)

Strain Designations: QM 1276 [ATCC 9598, ATCC 9602, CBS 513.65, CCC-T-191b, IMI 15949, LSHB Ac86, LSHB Ac95, MIT 213, NCTC 3887, NCTC 978, NRRL 1, NRRL 1656, QM 7404, Thom 107, WB 1]  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Strain Designations QM 1276 [ATCC 9598, ATCC 9602, CBS 513.65, CCC-T-191b, IMI 15949, LSHB Ac86, LSHB Ac95, MIT 213, NCTC 3887, NCTC 978, NRRL 1, NRRL 1656, QM 7404, Thom 107, WB 1]
Application
Produces patulin clavacin, clavatin, claviformin
Biosafety Level 1
Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain yes
Intended Use
Preceptrol® no
Genome Sequenced Strain

Yes

Comments
Atypical strain
Genome sequencing strain (J. Craig Venter Institute, USA).
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

CTTAGACGGGGGCCATGCCCGAAGCATCCTCTGCAAATTACAATGCGGACCCCGAAGGAGCCAGCTTTCAAATTTGAGCTCTTGCCGCTTCACTCGCCGTTACTGAGGCAATCCCTGTTGGTTTCTTTTCCTCCGCTTATTGATATGCTTAAGTTCAGCGGGTATCCCTACCTGATCCGAGGTCAACCTTAGAAAAATTGGGTTGGTGTCGACAGGCGCCGGCCGGCCCTACAAGAGCGGGTGACAAAGCCCCATACGCTCGAGGACCGGACGCGGTGCCGCCGCTGCCTTTCGGGCCCGTCCCCGGGAAACCGGGGACGGGGGCCCAACACACAAGCCGTGCTTGAGGGCAGCAATGACGCTCGGACAGGCATGCCCCCCGGAATACCAGGGGGCGCAATGTGCGTTCAAAGACTCGATGATTCACTGAATTCTGCAATTCACATTAGTTATCGCATTTCGCTGCGTTCTTCATCGATGCCGGAACCAAGAGATCCGTTGTTGAAAGTTTTAACTGATTATGATAATCAACTCAGACTGCAAAACTTCAGAACAGAGTTCATGTTGTGGTCTTCGGCGGGCGCGGGCCCGGGGGCGCGGAGGCCTCCCCGGCGGCCGTCCGAAGACGGCGGGCCCGCCGAAGCAACAAGGTACGATAAACACGGGTGGGAGGTTGGACCCAGAGGGCCCGCACTCGGTAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTTACGACTTTTACTTCCTCTAAATGACCGGGTTTGACCAACTTTCCGGCTCTGGGGGGTCGTTGCCAACTCCCCTGAGCCAGTCCGAAGGCCTCACCGAGCCATTCAATCGGTAGTAGCGACGGGCGGTGTGTACAAAGGGC
Name of Depositor QM
Chain of Custody
ATCC <-- QM <-- NRRL 1656 <-- M.I.T. 213 <-- ATCC 1007 <-- C. Thom 107 <-- CBS strain Kral
Cross References

Nucleotide (GenBank) : AAKD03000000 Aspergillus clavatus NRRL 1, whole genome shotgun sequencing project.

Nucleotide (GenBank) : HQ026749 ITS including 5.8S rRNA gene

References

Fedorova ND, et al. Genomic islands in the pathogenic filamentous fungus Aspergillus fumigatus. PLoS Genet. 4: e1000046, 2008.

Joardar V, et al. Sequencing of mitochondrial genomes of nine Aspergillus and Penicillium species identifies mobile introns and accessory genes as main sources of genome size variability. BMC Genomics 13: 698, 2012. PubMed: 23234273

Kuprys PV, et al. Identification of telomerase RNAs from filamentous fungi reveals conservation with vertebrates and yeasts. PLoS One 8: e58661, 2013. PubMed: 23555591

Samson RA, Gams W. Typification of the species of Aspergillus and associated teleomorphs In Samson RA, Gams W. Advances in Penicillium and Aspergillus systematics. New York, Plenum Press pp. 31-54, 1985.

Waksman SA, et al. The production of two antibacterial substances, fumigacin and clavacin. Science 96: 202-203, 1942.

Wang H, et al. A fungal phylogeny based on 82 complete genomes using the composition vector method. BMC Evol. Biol. 9: 195, 2009.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation
Product Sheet
Product Sheet
Certificate of Analysis
Certificate of Analysis
SDS
SDS