Advanced Search

Aspergillus clavatus Desmazieres, anamorph (ATCC® 1007™)

Strain Designations: QM 1276 [ATCC 9598, ATCC 9602, CBS 513.65, CCC-T-191b, IMI 15949, LSHB Ac86, LSHB Ac95, MIT 213, NCTC 3887, NCTC 978, NRRL 1, NRRL 1656, QM 7404, Thom 107, WB 1]  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Strain Designations QM 1276 [ATCC 9598, ATCC 9602, CBS 513.65, CCC-T-191b, IMI 15949, LSHB Ac86, LSHB Ac95, MIT 213, NCTC 3887, NCTC 978, NRRL 1, NRRL 1656, QM 7404, Thom 107, WB 1]
Application
Produces patulin clavacin, clavatin, claviformin
Biosafety Level 1
Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain yes
Intended Use
Preceptrol® no
Genome Sequenced Strain

Yes

Comments
Atypical strain
Genome sequencing strain (J. Craig Venter Institute, USA).
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

CTTAGACGGGGGCCATGCCCGAAGCATCCTCTGCAAATTACAATGCGGACCCCGAAGGAGCCAGCTTTCAAATTTGAGCTCTTGCCGCTTCACTCGCCGTTACTGAGGCAATCCCTGTTGGTTTCTTTTCCTCCGCTTATTGATATGCTTAAGTTCAGCGGGTATCCCTACCTGATCCGAGGTCAACCTTAGAAAAATTGGGTTGGTGTCGACAGGCGCCGGCCGGCCCTACAAGAGCGGGTGACAAAGCCCCATACGCTCGAGGACCGGACGCGGTGCCGCCGCTGCCTTTCGGGCCCGTCCCCGGGAAACCGGGGACGGGGGCCCAACACACAAGCCGTGCTTGAGGGCAGCAATGACGCTCGGACAGGCATGCCCCCCGGAATACCAGGGGGCGCAATGTGCGTTCAAAGACTCGATGATTCACTGAATTCTGCAATTCACATTAGTTATCGCATTTCGCTGCGTTCTTCATCGATGCCGGAACCAAGAGATCCGTTGTTGAAAGTTTTAACTGATTATGATAATCAACTCAGACTGCAAAACTTCAGAACAGAGTTCATGTTGTGGTCTTCGGCGGGCGCGGGCCCGGGGGCGCGGAGGCCTCCCCGGCGGCCGTCCGAAGACGGCGGGCCCGCCGAAGCAACAAGGTACGATAAACACGGGTGGGAGGTTGGACCCAGAGGGCCCGCACTCGGTAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTTACGACTTTTACTTCCTCTAAATGACCGGGTTTGACCAACTTTCCGGCTCTGGGGGGTCGTTGCCAACTCCCCTGAGCCAGTCCGAAGGCCTCACCGAGCCATTCAATCGGTAGTAGCGACGGGCGGTGTGTACAAAGGGC
Name of Depositor QM
Chain of Custody
ATCC <-- QM <-- NRRL 1656 <-- M.I.T. 213 <-- ATCC 1007 <-- C. Thom 107 <-- CBS strain Kral
Cross References

Nucleotide (GenBank) : AAKD03000000 Aspergillus clavatus NRRL 1, whole genome shotgun sequencing project.

Nucleotide (GenBank) : HQ026749 ITS including 5.8S rRNA gene

References

Fedorova ND, et al. Genomic islands in the pathogenic filamentous fungus Aspergillus fumigatus. PLoS Genet. 4: e1000046, 2008.

Joardar V, et al. Sequencing of mitochondrial genomes of nine Aspergillus and Penicillium species identifies mobile introns and accessory genes as main sources of genome size variability. BMC Genomics 13: 698, 2012. PubMed: 23234273

Kuprys PV, et al. Identification of telomerase RNAs from filamentous fungi reveals conservation with vertebrates and yeasts. PLoS One 8: e58661, 2013. PubMed: 23555591

Samson RA, Gams WTypification of the species of Aspergillus and associated teleomorphsIn: Samson RA, Gams WAdvances in Penicillium and Aspergillus systematicsNew YorkPlenum Presspp. 31-54, 1985

Waksman SA, et al. The production of two antibacterial substances, fumigacin and clavacin. Science 96: 202-203, 1942.

Wang H, et al. A fungal phylogeny based on 82 complete genomes using the composition vector method. BMC Evol. Biol. 9: 195, 2009.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation
Product Sheet
Product Sheet
Certificate of Analysis
Certificate of Analysis
MSDS
MSDS