Candida jeffriesii Nguyen et al. (ATCC® MYA-4346)

Strain Designations: BG 02-6-6-1-10 [CBS 9898, NRRL Y-27738]  /  Product Format: frozen

Strain Designations BG 02-6-6-1-10 [CBS 9898, NRRL Y-27738]
Application
Ferments pentose (xylose).
Bioethanol production
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain yes
Preceptrol® no
Comments
Insect associated yeast. Isolated from digestive tract of tropical beetle living in woody substrates.
Medium ATCC® Medium 28: Emmons' modification of Sabouraud's agar
ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 1245: YEPD
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

TTTCCGTAGGTGAACCTGCGGAAGGATCATTACTGTTTCTGCGCTTAATTGCGCGATCTACACACGATGTTTTTTATATCAACTTGCTTTGGTCTGGCGGTAGTCGGGCCAGAGGTAAACTCAACCAATATTTATTATTTGTCAACAACATACTAATGTTAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATATGAATTGCAGATATTCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTTTGAGCGTCATTTCTCTCTCAAGCCCTCGGGTTTGGTGTTGAGTGATACTCCCAGTCAGACTCGGCGTTTTCTTGAAAGGCCTCGGCGTGAGCTACGACAATGTATTAGGTTCATCCAACTCGTTGTCAGCAGCGCACGCGCCCTTACAAATCAACCAAAGTTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA


D1D2 region of the 26S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAGCGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCAGTTTCACTGTCCGAGTTGTAATTTGAAGAAGGTATCTTTGGGTCTGGCGCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGACGGGCTGCCCAGATCCGTGTAAAGTTCCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCATGCGATCAGACTTGGTATTTTGTATGTCTTGCTTTCGGGCGGGGCCTCTGCAGCTTACTGGGCCAGCATCGGTTCGGGTGGCAGGACAATTGCGGAGAAATGTGGCACGGCCTCGGTTGTGTGTTATAGTCTCTGTCGATACTGCCTGCCTGGACCGAGGACTGCGTCTTACGACTAGGATGCTGGCATAATGATCGTACGCCGCCCGTCTTG

Name of Depositor SO Suh
Special Collection ATCC
Chain of Custody
ATCC <-- SO Suh
Isolation
Gut of Phrenapates bennetti (Tenebrionidae), Chiriqui, Panama
Cross References

Nucleotide (GenBank) : FJ623615 ITS including 5.8S rRNA gene

Nucleotide (GenBank) : FJ614682 D1/D2 region of 28S rRNA gene

Nucleotide (GenBank) : KC507445 EF-1 alpha gene

Nucleotide (GenBank) : KC507414 RPB1 gene

Nucleotide (GenBank) : KC512840 RPB2 gene

References

Suh SO, et al. Scheffersomyces parashehatae f.a., sp. nov., Scheffersomyces xylosifermentans f.a., sp. nov., Candida broadrunensis sp. nov., and Candida manassasensis sp. nov., four novel yeasts associated with wood- ingesting insects and their ecological and biofuel implications. Int. J. Syst. Evol. Microbiol. 63: 4330-4339, 2013. PubMed: 24014624