Schizochytrium aggregatum Goldstein et Belsky (ATCC® 28209)

Strain Designations: 16  /  Product Format: frozen

Classification KINGDOM: Chromista
Strain Designations 16
Application
Biofuel production
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Genome Sequenced Strain

Yes

Comments
Genome sequencing strain (the Joint Genome Institute at the Department of Energy, USA).
Morphology After 6 days on BY+ medium at 20°C, colonies cream-colored, granular. Vegetative cells irregularly shaped, guttulate. Thalli and hyphae not observed.
Medium ATCC® Medium 790: By+ medium
Growth Conditions
Temperature: 20°C
Atmosphere: Typical aerobic
Sequenced Data
Partial 18S ribosomal RNA gene

CCTTAGATGTTCTGGGCCGCACGCGCGCTACACTGACTGGGGGAGCACGTTGCTTTGTCGTACGACAACGTCCTGGGCCGGAAGGTTTGGGTAATCGTGTGAATACCAGTCGTGATGGGGCTAGATCTTTGCAATTATTGATCTCCAACGAGGAATTCCTAGTAAACGCAAGTCATCAGCTTGCATTGATTACGTCCCTGCCCTTTGTACACACCGCCCGTCGCACCTACCGATTGAACGTTCCGGTGAGACCTTCGGAGGGCACGATGTTCCTGGCGACAGGACGTGGTGGCCAAAGTTGAGCAAACCTTAACGTTTAGAGGAAGGTGAAGTCGTAACAAGGTT

Morphology After 6 days on BY+ medium at 20°C, colonies cream-colored, granular. Vegetative cells irregularly shaped, guttulate. Thalli and hyphae not observed.
Name of Depositor DJ Alderman
Chain of Custody
ATCC <-- DJ Alderman <-- J Schneider
Isolation
seawater, West Germany
Cross References

Nucleotide (GenBank) : M13616 Schizochytrium aggregatum 5S rRNA.

Nucleotide (GenBank) : X06104 Schizochytorium aggregatum 5S ribosomal RNA.

References

Tsui CKM, et al. Labyrinthulomycetes phylogeny and its implications for the evolutionary loss of chloroplasts and gain of ectoplasmic gliding. Mol. Phylogenet. Evol. 50: 129-140, 2009. PubMed: 18977305