Verticillium albo-atrum Reinke et Berthold (ATCC® MYA-4576)

Strain Designations: Ms102 [VaMs102, FGSC 10136]  /  Product Format: frozen

Strain Designations Ms102 [VaMs102, FGSC 10136]
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Genome Sequenced Strain

Yes

Comments
Plant pathogen
Genome sequencing strain (Broad Institute, USA)
This strain is also known as Verticillium alfalfae
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

AACCAGCGGAGGGATCATTACCGAGTATCTACTCATAACCCTTTGTGAACCATATTGTTGCTTCGGCGGCTCGTTCTGCGAGCCCGCCGGTACATCAGTCTCTTTATTTATACCAACGATACTTCTGAGTGTTCTTAGCGAACTATTAAAACTTTTAACAACGGATCTCTTGGCTCTAGCATCGATGAAGAACGCAGCGAAACGCGATATGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATGGCGCCTTCCAGTATCCTGGGAGGCATGCCTGTCCGAGCGTCGTTTCAACCCTCGAGCCCCAGTGGCCCGGTGTTGGGGATCTACGTCTGTAGGCCCTTAAAAGCAGTGGCGGACCCGCGTGGCCCTTCCTTGCGTAGTAATTACAGCTCGCATCGGAGTCCCGCAGGCACTTGCCTCTAAACCCCCTACAAGCCCGCCTCGTGCGGCAACGGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATA

Name of Depositor KV Subbarao
Special Collection ATCC
Chain of Custody
ATCC <-- KV Subbarao
Isolation
Alfalfa (Medicago sativa), Pennsylvania, USA.
Cross References

Nucleotide (GenBank) : GU291258 ITS including 5.8S rRNA gene

Nucleotide (GenBank) : ABPE00000000 Verticillium alfalfae VaMs.102, whole genome shotgun sequencing project

References

Qin QM, et al. Phylogenetic analyses of phytopathogenic isolates of Verticillium spp. Phytopathology 96: 582-592, 2006.

Wang H, et al. A fungal phylogeny based on 82 complete genomes using the composition vector method. BMC Evol. Biol. 9: 195, 2009. PubMed: 19664262