Flammulina velutipes (Curtis : Fries) Singer, teleomorph (ATCC® 34574)

Strain Designations: SN-2 [N-1432]  /  Product Format: frozen

Deposited As Gremmeniella abietina (Lagerberg) Morlet
Strain Designations SN-2 [N-1432]
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Type Strain no
Preceptrol® no
Comments Plant pathogen
The species identity was confirmed by ITS sequence.
Medium ATCC® Medium 324: Malt extract agar
ATCC® Medium 336: Potato dextrose agar (PDA)
ATCC® Medium 343: V8 juice agar
Growth Conditions
Temperature: 15°C to 20°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAATGAACTTTGAACTGCTTGTGGCTCTTGGGCTGTTGCTGACGAGGACCTTCACGGGTTCTTCGTACGTGCACGTCTGGGGTTGCAGCTTTCTTCGTCCACCTGTGCACACTCTGTAGGTCTGGATACCCCATTGGAAGGGTGCGCTTTTTGCGCTCCCTTTGCCTTCCAGGCCTATGTCTTACAAACACTATAGTATGTAACGAATGTCATTGATTATTGGACTTCACTGTCCTTTAAACTAAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACCTTGCGCCCTTTGGTACTCCGAAGGGCATGCCTGTTTGAGTGTCAGTAACTTCTCAACCTCCCTCACTTTGTTGTGAGCTGGCGGATTGGATGTGGGGGCTTGCTGGACCTTATCTTTGGGTTCAGCTCCCCTGAAATGCATTAGCAGAAACCGTTACCTTTTGGCGCGCTGCAGCTGTGATAATTATCTACGGCTATGGCTGGGCTGACTGTGTTGTAGCGCTCGTCTCGTCTCTGAAGTGGTTTCGCCTTAGTTGGTGCTTCCCTTTGCCTTCTCTCTCACGAGAGATACCTGTGACGCGAGTGCGCGGGCTATTCCGCTTCTAACCGTCCCCTTGTGGGACAAACTATTGACCATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAA

Name of Depositor CE Dorworth
Chain of Custody
ATCC <-- CE Dorworth <-- F Roll-Hansen N-1432
Isolation
Picea abies, Norway
References

Dorworth CE, Krywienczyk J. Comparisons among isolates of Gremmeniella abietina by means of growth rate, conidia measurement, and immunogenic reaction. Can. J. Bot. 53: 2506-2525, 1975.