Cladosporium halotolerans Zalar et al. (ATCC® 10391)

Strain Designations: NRRL 1671  /  Product Format: freeze-dried

Deposited As Cladosporium fulvum Cooke
Strain Designations NRRL 1671
Application
Plant disease research
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Comments The fungus was re-identified as Cladosporium halotolerans based on the multigene sequence analysis
Medium ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 324: Malt extract agar
ATCC® Medium 336: Potato dextrose agar (PDA)
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

GGTCTCCGTAGGTGAACCTGCGGAGGGATCATTACAAGTTGACCCCGGCCCTCGGGCCGGGATGTTCACAACCCTTTGTTGTCCGACTCTGTTGCCTCCGGGGCGACCCTGCCTCCGGGCGGGGGCCCCGGGTGGACATTTCAAACTCTTGCGTAACTTTGCAGTCTGAGTAAATTTAATTAATAAATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCGACGCGGTCCGCCGCGCGCCTCAAATCGACCGGCTGGGTCTTTCGTCCCCTCAGCGTTGTGGAAACTATTCGCTAAAGGGTGCCGCGGGAGGCCACGCCGTAAAACAACCCCATTTCTAAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAA


D1D2 region of the 28S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCTCTAGTAACGGCGAGTGAAGCAGCAATAGCTCAAATTTGAAATCTGGCGTCTTCGGCGTCCGAGTTGTAATTTGTAGAGGATGCTTCTGGGCAGCCACCGACCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGTCGGAAAGGCACCCTACACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAACATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGGGATTGCAACCAGACTTGCTCGCGGTGTTCCGCCGGTCTTCTGACCGGTCTACTCGCCGCGTTGCAGGCCAGCATCGTCTGGTGCCGCTGGATAAGACTTGAGGAATGTAGCTCCCTCGGGAGTGTTATAGCCTCTTGTGATGCAGCGAGCGCCGGGCGAGGTCCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAATCCGC


Elongation factor 1-alpha gene

TGAGCCTCACTTTGGCGATTCTGCATCTCGACGTGGCATTTTCTGCACTGCCCCACCATACCACCCCACCGCACCGCTATCTGCGATAAGGCGTTCCGGGATGGCTTGGCGTGCGCCCGAGGGGTTTCAAGCCCCACGTTCAGTCTTTGCCACGACGTGAAACAGCATCGCAACACCACGCCTAACGAACAAAAACAACATGCTGACAACCAATATAGGAAGCCGCCGAGCTC


Actin gene

CGGCGACGATGCGCCCAGAGCCGTTTTCCGTAAGTTCTCACCACCCACGCTCTTCACGCACCGGACCACTCGGCTGACCGCCTCTCAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCATCCTCCCCGCGCCCGCCGCCGAGGCCACCCCGTTCTAACCGCAGCGCAGTATCATGATCGGT

Name of Depositor NRRL
Isolation
Infected tomato plant