Trichoderma atroviride Karsten sensu Bissett (ATCC® 20476)

Alternate State: Hypocrea atroviridis Dodd et al.  /  Strain Designations: T  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Deposited As Trichoderma viride Persoon : Fries
Strain Designations T
Alternate State Hypocrea atroviridis Dodd et al.
Application
Biological control of wood decay fungi
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Disclosure This material is cited in a US or other Patent and may not be used to infringe the claims. Depending on the wishes of the Depositor, ATCC may be required to inform the Patent Depositor of the party to which the material was furnished. This material may not have been produced or characterized by ATCC.
Preceptrol® no
Morphology On malt extract medium after 3-4 days colonies with rapid growth, cream-colored at first, soon becoming green due to abundant sporulation, starting at the edge of the colony.  Conidiophores hyaline, loosely branched at right angles.  Phialides flask-shaped, with very short, hardly visible collarettes.  Conidia spherical to ellipsoidal, pale green
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

GGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTTACAACTCCCAAACCCAATGTGAACCATACCAAACTGTTGCCTCGGCGGGGTCACGCCCCGGGTGCGTCGCAGCCCCGGAACCAGGCGCCCGCCGGAGGGACCAACCAAACTCTTTTCTGTAGTCCCCTCGCGGACGTTATTTCTTACAGCTCTGAGCAAAAATTCAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCAACCCTCGAACCCCTCCGGGGGGTCGGCGTTGGGGACCTCGGGAGCCCCTAAGACGGGATCCCGGCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCCTGCGCAGTAGTTTGCACAACTCGCACCGGGAGCGCGGCGCGTCCACGTCCGTAAAACACCCAACTTCTGAAATGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAA


D1D2 region of the 28S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCCTAGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGTGAGGTGCCGCCCGAGTTCCCTGGAACGGGACGCCGCAGAGGGTGAGAGCCCCGTCTGGCTGGCCACCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGAGGGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGGGCGCGGCGGATCATCCGGGGTTCTCCCCGGTGCACTTCGCCGTGTTCAGGCCAGCATCAGTTCGGCGCGGGGGAAAAAGGCTTCGGGAACGTGGCTCCTCCGGGAGTGTTATAGCCCGTTGCATAATACCCTGCGCTGGACTGAGGACCGCGCATCTGCAAGGATGCTGGCGTAATGGTCACCAGCGAC

Morphology On malt extract medium after 3-4 days colonies with rapid growth, cream-colored at first, soon becoming green due to abundant sporulation, starting at the edge of the colony.  Conidiophores hyaline, loosely branched at right angles.  Phialides flask-shaped, with very short, hardly visible collarettes.  Conidia spherical to ellipsoidal, pale green
Name of Depositor BINAB
U.S. Patent Number
Disclosure This material is cited in a US or other Patent and may not be used to infringe the claims. Depending on the wishes of the Depositor, ATCC may be required to inform the Patent Depositor of the party to which the material was furnished. This material may not have been produced or characterized by ATCC.
Isolation
Plum tree, Sweden
References

Highley TL, Ricard J. Antagonism of Trichoderma spp. and Gliocladium virens against wood decay fungi. Mater. Org. 23: 157-169, 1988.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation