Magnusiomyces capitatus (de Hoog et al.) de Hoog et Smith (ATCC® 10663)

Strain Designations: NRRL Y-1487 [CBS 2364, CBS 571.82, FMJ 15014, IFO 1197, JCM 6258]  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Deposited As Trichosporon capitatum Diddens et Lodder
Strain Designations NRRL Y-1487 [CBS 2364, CBS 571.82, FMJ 15014, IFO 1197, JCM 6258]
Application
Quality control strain for API products
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain yes (lectotype of Trichosporon capitatum)
Preceptrol® no
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTCACAAGATTATATTTTATATTACTTTGTGGAACATTTGGTTGAATTTACATGTTTTATTACAAAAAATTAATTATAATTAAAAAAATAATTTTAAGAAAACCTCCAACAACGGATCTCTTGGTTCCCAGATCGATGAAGAGCGCAGCGAATTGCGAAATGTGATGTGTATTGCAGTGAATCATCAATTCTTGAACGCACATGGCACCCCTTTTAGGGGTATGCTTGTATGAGGGTGTTTAATATGAAATTGCTTTGGCTTTTTTTAAATAAATGGTTTTTCAAATTGTTACTAATAGACGAAAGAATCAGTGCAACAAGCTGTGTTGAATCTTTCATTAAATCTTTTAGTTAACTACTTTAACTATTTGCACCTCATATCAAGCAAGACTACCCGCTGAACTTAAGCATATCAATAA


D1D2 region of the 26S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAATTTGAAAACGCTTCGGCGTGTTGTAAGTAAAGTGGTTAGACGCTTTTTAATAAGTCCCTTGGAACAGGGCGCCATAGAGGGTGATAGCCCCGTATTAAATTGTCTAGTGTGCTACTTTAGAGCGAGTCGAGTTGTTTGGGAATGCAGCTCAAATAGGTGGTAAACTCCATCTAAAGCTAAATATTGCTGGGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGCACTTTGAAAAGAGAGTGAAATAGCGTGTGAAATTGTTGGAGGGGAAGGCGATGGTAGGAATAAGAGGCTGCGGTTTGAAATAATTGTTTTTCGGGCCACGGTCTCCTGAGCCTGCTTTCGCAC

Name of Depositor NRRL
Chain of Custody
ATCC <-- NRRL<-- CBS 2364
Isolation
Wood pulp, Sweden
Cross References

Nucleotide (GenBank) : AX109673 Sequence 406 from Patent WO0123604.

Nucleotide (GenBank) : AX109726 Sequence 459 from Patent WO0123604.

Nucleotide (GenBank) : AX109766 Sequence 499 from Patent WO0123604.

Nucleotide (GenBank) : U26863 Blastoschizomyces capitatus isolate g55 28S rRNA gene, partial

References

Salkin IF, et al. Blastoschizomyces capitatus, a new combination. Mycotaxon 22: 375-380, 1985.

von Arx JA, et al. The genera of the yeasts and the yeast-like fungi. Stud. Mycol. 14: 1-42, 1977.

King DS, Jong SC. A contribution to the genus Trichosporon. Mycotaxon 6: 391-417, 1977.

lectotype of Trichosporon capitatum

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation