Teunomyces gatunensis (Suh et al.) Kurtzman et Blackwell (ATCC® MYA-4355)

Strain Designations: BG 05-8-8-005A-2-2 [CBS 10379, NRRL Y-48064]  /  Product Format: frozen

Permits and Restrictions

View Permits

Deposited As Candida gatunensis Suh et al.
Strain Designations BG 05-8-8-005A-2-2 [CBS 10379, NRRL Y-48064]
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain yes
Preceptrol® no
Comments
Insect associated yeast isolated from digestive tract of tropical mushroom feeding beetle.
Medium ATCC® Medium 28: Emmons' modification of Sabouraud's agar
ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 1245: YEPD
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

TTTCCGTAGGTGAACCTGCGGAAGGATCATTAGAGAGAATTATTACACGTGTTTTCACTAAATAAATTATTAAACGTTATTATTATTATTATTGTTATCAAGATAATCTAAAATCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTATTATGAATTGCAGATTTTCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTGTGGTATTCCACAGGGCATGCCTGTTTGAGCGTCATTTCTCTCTCAAGCTTTTTAGCTTGGTGTTGAGTTTGCTCGGCTTACTTGAAAAAAATATGAGTGTAATTGTTTAGGTTGTACCAAATCTTTTACACAAAACACCATAACAAGTTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA


D1D2 region of the 26S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTCCGTAAAGGCGAGTTGTAATTTGAAGAAGCGACTTTGGACTGGTTCCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGGGCCACCAGTGCATGTAAAGTGCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGCACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTGACTCGTCACTGGGCCAGCATCGGTTTGGGTGGTAGGACAATACCGTAGGAACGTAGCTCATTTTTTGAGTGTTATAGGCTGCGGGGATACTGCCTATCCAGACCGAGGACTGCGGCAACTAGGATGCTGGCATAATGATCTTAAGCCGC

Name of Depositor SO Suh
Special Collection ATCC
Chain of Custody
ATCC <-- SO Suh
Isolation
Gut of Pallodes sp. (Nitidulidae) ex Hydropus sp., Barro Colorado Island, Panama.
Cross References

Nucleotide (GenBank) : FJ614690 D1/D2 region of 28S rRNA gene

Nucleotide (GenBank) : FJ623620 ITS including 5.8S rRNA gene

References

Suh SO, Nguyen NH, Blackwell M. A yeast clade near Candida kruisii uncovered: nine novel Candida species associated with basidioma-feeding beetles. Mycol. Res. 110: 1379-1394, 2006. PubMed: 17113766

Kurtzman CP, Robnett CJ, Blackwell M. Description of Teunomyces gen. nov. for the Candida kruisii clade, Suhomyces gen. nov. for the Candida tanzawaensis clade and Suhomyces kilbournensis sp. nov. FEMS Yeast Res 16(5). pii: fow041, 2016. PubMed: 27188882

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation