pS356 (ATCC® 67683)

Applications: YX-type (expression) shuttle vectorvector permitting construction of fusion proteins  /  Depositors: Chiron Corp., MS Richman, Chiron Corp.

Designations pS356
Permits and Restrictions

View Permits

Depositors Chiron Corp., MS Richman, Chiron Corp.
U.S. Patent
Disclosure This material is cited in a US or other Patent and may not be used to infringe the claims. Depending on the wishes of the Depositor, ATCC may be required to inform the Patent Depositor of the party to which the material was furnished. This material may not have been produced or characterized by ATCC.
Biosafety Level 1
Vector Information
Size (kb): 5.8000001907348630
Vector: pS356 (plasmid)
Promoters: Promoter GAPDH
Construction: pYASI1
Marker(s):LEU2,ampR
Construct size (kb): 5.800000190734863
Features: marker(s): LEU2
marker(s): ampR
promoter: GAPDH
regulator: ADH2
replicon: 2 micron
replicon: pMB1
transcription terminator: GAPDH
coding sequence: SOD
Applications
YX-type (expression) shuttle vector
vector permitting construction of fusion proteins
Comments
Restriction digests of the clone give the following sizes (kb): EcoRI--5.8; BamHI--3.7, 2.1; NcoI--5.8.
Shuttle expression vector producing fusion proteins with human SOD (after Gln154 of SOD). Expression is regulated by the ADH2 UAS.
Constructed from pYASI1 by replacing the met-proinsulin sequence immediately downstream of Gln154 of the human SOD coding sequence with an EcoRI-containing adaptor: 5'AATTTGGGAATTCCATAATTAATTAAG3' /3'ACCCTTAAGGTATTAATTAATTCAGCT5'.
Media ATCC® Medium 1227: LB Medium (ATCC medium 1065) with 50 mcg/ml ampicillin
Growth Conditions
Temperature: 37.0°C
References

Houghton M, et al. Hepatitis C virus protease. US Patent 5,371,017 dated Dec 6 1994

Cousens LS, et al. High level expression of proinsulin in the yeast, Saccharomyces cerevisiae. Gene 61: 265-275, 1987. PubMed: 3328732

Shipped freeze-dried
Shipping Information Distributed: freeze-dried