Scedosporium boydii (Shear) Gilgado et al. (ATCC® 64215)

Strain Designations: 2  /  Product Format: frozen

Deposited As Scedosporium apiospermum (Saccardo) Castellani et Chalmers
Strain Designations 2
Application
Biomedical Research and Development Material
Biosafety Level 2

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Comments
case report
Medium ATCC® Medium 323: Malt agar medium
ATCC® Medium 260: Trypticase soy agar/broth with defibrinated sheep blood
Growth Conditions
Temperature: 25°C to 37°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

AGGGATCATTACAGAGTTACTACTCCAAACCCATTGTGAACCTTACCTATGTTCTGTTGCCTCGGCGGCGTGGTCAGCGCCCCCTCTGAAAAGAGGACGATGCCCTCCCGCCGGCAGCACCAAACTCTTTGAATTTTACAGCGGATTACAGTTCTGATTTGAAAACAAAAAACAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGGCAGTAATCTGCCGGGCATGCCTGTCCGAGCGTCATTTCAACCCTCGAACCTCCGTTTCCTCAGGGAAGCTCAGGGTCGGTGTTGGGGCGCTACGGCGAGTCTTCGCGACCCTCCGTAGGCCCTGAAATACAGTGGCGGTCCCGCCGCGGTTGCCTTCTGCGTAGTAAGTCTCTTTTGCAAGCTCGCATTGGGTCCCGGCGGAGGCCTGCCGTCAAACCACCTATAACTCCAGATGGTTTGACCTCGGATCAGGTAGGGTTACCCGCTGAACTTAAG


D1D2 region of the 28S ribosomal RNA gene

CATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCGGCCTCTGGGCCGTCCGAGTTGTAATTTGAAGAGGATGCTTTTGGCGAGGCGCCTTCCGAGTGCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTATGGTTGGACGCCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAACCCCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGACTTGTGCCCGTCGAATCAGCCGCCGCTCGTCGGCGGCGCACTTCGGCGGGCTCAGGCCAGCATCAGTTCGCTGCAGGGGGAGAAAGGCGATGGGAATGTGGCTCTTCGGAGTGTTATAGCCCGCCGCGCAATACCCCTCGGCGGACTGAGGACCGCGCATCTGCAAGGATGCTGGCGTAATGGTCGTCAGCGA

Name of Depositor MA Piens
Isolation
Human lung biopsy, France
Cross References

Nucleotide (GenBank) : AF117942 Pseudallescheria boydii ATCC 64215 5.8S ribosomal RNA gene, partial

References

Guyotat D, et al. A case of disseminated Scedosporium apiospermum infection after bone marrow transplantation. Mykosen 30: 151-154, 1987. PubMed: 3295538