Lipomyces starkeyi Lodder et Kreger-van Rij (ATCC® 58680)

Strain Designations: NRRL Y-1388 [NRRL Y-11557, CBS 1807, CCRC 21522, IFO 10381, IFO 1289, JCM 5995, R.L. Starkey 74]  /  Product Format: frozen

Permits and Restrictions

View Permits

Strain Designations NRRL Y-1388 [NRRL Y-11557, CBS 1807, CCRC 21522, IFO 10381, IFO 1289, JCM 5995, R.L. Starkey 74]
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain yes
Preceptrol® no
Genome Sequenced Strain

Yes

Comments
Genome sequencing strain (the Joint Genome Institute at the Department of Energy, USA).
Morphology After 5 days growth is scant, white to light cream-colored, glistening, smooth, and mucoid. Cells are globose to ellipsoidal, (4-7 x 5-11 µm). 
Medium ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 1245: YEPD
ATCC® Medium 28: Emmons' modification of Sabouraud's agar
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal   transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

GAAAACGTTCCGTAGGTGAACCTGCGGAAGGATCATTACTGAGTATGTGTCTTTTATAGACATCTCTCTATCCATAAACTCTTTTTTAAAAAGACATGATTTACATAATTAGTCTGAATGTTTATTTAAAATCTTCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCAAAATGCGATAAGTATTGTGAATTGCAGGATTTTGTGAATCATCGAATTTTTGAACGCACATTGCACCTTCTGGTATTCCGGAGGGTATACCTGTTTGAGCGTCATTTATATACTCAAAACTTCGTTTTGGTTGTGGGCACGTATCTGGCGTAAGCTAGATTTGCCTGAAATATAGTGGTAGAGATCGCTACAAGTGATGCAAGTTAGCCAATGCTATTAAGTTAATTCGTTGGTGAAGCATGTGGAGCTTTAGTGATAGTCTTCCTTAATTATTGGAATTTTTTCTAATTTTGACCTCAAATCAGGCAGGAGTACCCGCTGAACTTAAG


D1D2 region of the 26S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAACTGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAATCTGGCACCTTCGGTGTCCGAGTTGTAATTTGTAGAAGCATCTTTTGGATTGGTCCTTGCATATGTTCCTTGGAACAGGACATCATAGAGGGTGAGAATCCCGTTCATGGTGGGGAATCCAATTCTTTGTAAAGTGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTCCGAAAGGAGAGTGAAAAAGGACGTGAAATTGTTGAAAGGGAAGTGCTTGAGATCAGTCTTAAGGTTTAGTGATCAGTCTTCCTTTTGGTTGGTGCACTCACTATTTCTTAGGCCAACATCAGTTTTGGCGGCAGGATAATGACATTGGAATGTGGCTCTTTCGGGAGTGTTATAGCCTTTGTTGATACTGCCTGCTTAGACTGAGGACTGCGCTTTTGCTAGG

Morphology After 5 days growth is scant, white to light cream-colored, glistening, smooth, and mucoid. Cells are globose to ellipsoidal, (4-7 x 5-11 µm). 
Name of Depositor NRRL
Isolation
Soil, USA
Cross References

Nucleotide (GenBank) : JQ745260 ITS including 5.8S rRNA gene

Nucleotide (GenBank) : JQ745266 D1/D2 region of 26S rRNA gene

Nucleotide (GenBank) : LSGR00000000 Lipomyces starkeyi NRRL Y-11557, whole genome shotgun sequencing project

References

Kurtzman CP, Robnett CJ. Relationships among genera of the Saccharomycotina (Ascomycota) from multigene phylogenetic analysis of type species. FEMS Yeast Res. 13: 23-33, 2013. PubMed: 22978764

Oguri E, et al. Phylogenetic and biochemical characterization of the oil-producing yeast Lipomyces starkeyi. Antonie Van Leeuwenhoek 101: 359-368, 2012. PubMed: 21927827

Schoch CL, et al. Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for Fungi. Proc Natl Acad Sci USA 109: 6241-6246, 2012. PubMed: 22454494

Kurtzman CP, Albertyn J, Basehoar-Powers E. Multigene phylogenetic analysis of the Lipomycetaceae and the proposed transfer of Zygozyma species to Lipomyces and Babjevia anomala to Dipodascopsis. FEMS Yeast Res. 7: 1027-1034, 2007. PubMed: 17498213

Gouliamova DE, et al. Diversity and affinities among species and strains of Lipomyces. Antonie Van Leeuwenhoek 74: 283-291, 1998. PubMed: 10081588

Kurtzman CP, Robnett CJ. Identification of clinically important ascomycetous yeasts based on nucleotide divergence in the 5' end of the large-subunit (26S) ribosomal DNA gene. J Clin Microbiol 35: 1216-1223, 1997. PubMed: 9114410

Kurtzman CP. Systematics of the ascomycetous yeasts assessed from ribosomal RNA sequence divergence. Antonie Van Leeuwenhoek 63: 165-174, 1993. PubMed: 8259833

Riley R, et al. Comparative genomics of biotechnologically important yeasts. Proc Natl Acad Sci USA 2016 Aug 17. pii: 201603941. PubMed: 27535936

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation