Yarrowia lipolytica (Wickerham et al.) van der Walt et von Arx (ATCC® 18944)

Alternate State: Candida lipolytica (Harrison) Diddens et Lodder  /  Strain Designations: NRRL YB-423-12 [CBS 6124.2, IFO 1551, IGC 4161, JCM 2305, VKM Y-2016, Z30]  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Deposited As Endomycopsis lipolytica Wickerham et al.
Strain Designations NRRL YB-423-12 [CBS 6124.2, IFO 1551, IGC 4161, JCM 2305, VKM Y-2016, Z30]
Synonym Endomycopsis lipolytica Wickerham et al., Saccharomycopsis lipolytica (Wickerham et al.) Yarrow
Alternate State Candida lipolytica (Harrison) Diddens et Lodder
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain yes
Preceptrol® no
Mating Type mating type B
Medium ATCC® Medium 28: Emmons' modification of Sabouraud's agar
ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 1245: YEPD
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

CTGTGGATTTCTGGTATATTACAGCGTCATTTTATCTCAATTATAACTATCAACAACgGATCTCTTGGCTCTCACATCGATGAAGAACGCAGCGAACCGCGATATTTTTTGTGACTTGCAGATGTGAATCATCAATCTTTGAACGCACATTGCGCGGTATGGYATTCCGTACCGCACGGATGGAGGAGCGTGTTCCCTCTGGGATCGCATTGCTTTCTTGAAATGGATTTTTT


D1D2 region of the 26S ribosomal RNA gene

CATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAACCCTCGGGATTGTAATTTGAAGATTTGGCATTGGAGAAAGCTAACCCAAGTTGCTTGGAATAGTACGTCATAGAGGGTGACAACCCCGTCTGGCTAACCGTTCTCCATGTATTGCCTTATCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAGTGGGTGGTAAACTCCATCTAAAGCTAAATACTGGTGAGAGACCGATAGCGAACAAGTACTGTGAAGGAAAGGTGAAAAGAACTTTGAAAAGAGAGTGAAATAGTATGTGAAATTGTTGATAGGGAAGGAAATGAGTGGAGAGTGGCCGAGGTTTCAGCCGCCCCTCGTGGGCGGTGTACTGCCGACGCCGAGTCATCGATAGCGAGACGAGGGTTACAAATGGGAGCGCCTTCGGGCGTTCTCCCCTAACCCTCCACACTGCCACCGACGACATAATCCACCCATTTCA

Name of Depositor NRRL
Isolation
Derived from ATCC 18942
References

. Spectrum, Monogr. Ser. Arts Sci.. 1Atlanta: Georgia State Univ.; 1970.

Gaillardin CM, et al. A study of copulation, sporulation and meiotic segregation in Candida lipolytica. Arch. Mikrobiol. 92: 69-83, 1973. PubMed: 4725824

Knutsen AK, et al. Polyphasic re-examination of Yarrowia lipolytica strains and the description of three novel Candida species: Candida oslonensis sp. nov., Candida alimentaria sp. nov. and Candida hollandica sp. nov. Int. J. Syst. Evol. Microbiol. 57: 2426-2435, 2007. PubMed: 17911320

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation