To ATCC Valued Customers,

ATCC stands ready to support our customers’ needs during the coronavirus pandemic. If you experience any issues with your products or services, please contact ATCC Customer Service at For Technical questions please contact Thank you.

Privacy Policy Update

We remain dedicated to protecting your data and experience throughout our platforms. We have updated our Privacy Policy and your continued use of the Site means you have accepted the revised Privacy Policy. View now >

Quantitative Synthetic SARS-CoV-2 RNA: Spike 3’ (ATCC® VR-3278SD)

Product Format: frozen
Specification range: 1 x 105 to 1 x 106 copies/µL
100 µL per vial with Biomatrica RNAstable

Permits and Restrictions

View Permits

Agent Quantitative Synthetic SARS-CoV-2 RNA: Spike 3’
Applications ATCC® Genuine Nucleics can be used for assay development, verification, validation, monitoring of day-to-day test variation, and lot-to-lot performance of molecular-based assays. The quantitative format allows for the generation of a standard curve for quantitative PCR (qPCR) to determine viral load.
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Specification range: 1 x 105 to 1 x 106 copies/µL
100 µL per vial with Biomatrica RNAstable
Storage Conditions -70°C or colder
Intended Use The synthetically engineered sequence of the product constitutes intellectual property belonging to ATCC. Unauthorized use, including sequencing, modification, or reverse-engineering, of the product is expressly prohibited without prior ATCC consent.

Biomatrica Logo

Manufactured under ISO 13485 guidance

Preparation includes a fragment from the 3’ Glycoprotein (Spike) region

The following primers and probe can be used with this nucleic acid preparation.
Forward primer (5’ to 3’): ATCAACTTACTCCTACTTGGCG
Reverse primer (5’ to 3’): ACCAATGGGTATGTCACACTC

Name of Depositor ATCC
Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation