Quantitative Synthetic Rift Valley fever virus DNA (ATCC® VR-3254SD)

Classification: Bunyaviridae, Phlebovirus  /  Product Format: frozen
Specification range: 1 x 105 to 1 x 106 copies/µL
100 µL per vial with Biomatrica DNAstable

Permits and Restrictions

View Permits

Classification Bunyaviridae, Phlebovirus
Agent Quantitative Synthetic Rift Valley fever virus DNA
Applications ATCC® Genuine Nucleics can be used for assay development, verification, validation, monitoring of day-to-day test variation, and lot-to-lot performance of molecular-based assays. The quantitative format allows for the generation of a standard curve for quantitative PCR (qPCR) to determine viral load.
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Specification range: 1 x 105 to 1 x 106 copies/µL
100 µL per vial with Biomatrica DNAstable
Storage Conditions -20°C or colder
Intended Use The synthetically engineered sequence of the product constitutes intellectual property belonging to ATCC. Unauthorized use, including sequencing, modification, or reverse-engineering, of the product is expressly prohibited without prior ATCC consent.

Biomatrica Logo
Comments Manufactured under ISO 13485 guidance

Preparation includes partial sequences of the long, medium, and small genome segments, including the Gn gene and the nonstructural genes (NSs and NSm).

The following primers and probe can be used with this nucleic acid preparation:
Forward primer: TGAAAATTCCTGAGACACATGG
Reverse primer: ACTTCCTTGCATCATCTGATG
Probe: FAM-CAATGTAAGGGGCCTGTGTGGACTTGTG-BHQ1

Name of Depositor ATCC
Special Collection DNA
References

Mwaengo D, et al. Detection and identification of Rift Valley fever virus in mosquito vectors by quantitative real-time PCR. Virus Res 169(1): 137-143, 2012. PubMed: 22841800

Cross References

Nucleotide (GenBank) : NC_014397.1 Rift Valley fever virus segment L, complete genome

Nucleotide (GenBank) : NC_014396.1 Rift Valley fever virus segment M, complete genome

Nucleotide (GenBank) : NC_014395.1 Rift Valley fever virus segment S, complete genome

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • This item is listed on the Commerce Control List of the U.S. Department of Commerce and is distributed only within the 50 United States. Distribution requires completion of a Customer Acceptance of Responsibility (CAR) for Commerce Control List (CCL) Biologicals form.
  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation