Candida albicans (Robin) Berkhout (ATCC® 28121)

Strain Designations: 304  /  Product Format: freeze-dried

Strain Designations 304
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Comments
Effect in guinea pig leucocytes
Morphology Colonies are white to cream-colored, butyrous to membranous, entire to erose margins. Cells globose-ovoid-ellipsoid, reproducing by budding. Pseudohyphae present.
Medium ATCC® Medium 28: Emmons' modification of Sabouraud's agar
ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 1245: YEPD
Growth Conditions
Temperature: 20°C to 25°C
Atmosphere: Typical aerobic
Sequenced Data
D1D2 region of the 26S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAGCGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCGTCTTTGGCGTCCGAGTTGTAATTTGAAGAAGGTATCTTTGGGCCCGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGACCCGGGTCTGTGTAAAGTTCCTTTGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCATGCTGCTCTCTCGGGGGCGGCCGCTGCGGTTTACCGGGCCAGCATCGGTTTGGAGCGGCAGGATAATGGCGGAGGAATGTGGCACGGCTTCTGCTGTGTGTTATAGCCTCTGACGATACTGCCAGCCTAGACCGAGGACTGCGGTTTTTTTACCTAGGATGTTGGCATAATGATCTTAAGTCGC

Morphology Colonies are white to cream-colored, butyrous to membranous, entire to erose margins. Cells globose-ovoid-ellipsoid, reproducing by budding. Pseudohyphae present.
Name of Depositor DH Howard
Isolation Feces, California
Cross References

Nucleotide (GenBank) : KU729162 D1/D2 region of 28S rRNA gene

References

Howard DH. Fate of Histoplasma capsulatum in guinea pig polymorphonuclear leukocytes. Infect. Immun. 8: 412-419, 1973. PubMed: 4125783