Malassezia furfur (Robin) Baillon, anamorph (ATCC® MYA-4874)

Strain Designations: M47  /  Product Format: frozen

Strain Designations M47
Biosafety Level 2

Biosafety  classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Comments
Clinical isolate
Lipophilic, but able to produce small colonies on Sabouraud agar without supplementation of lipids
Morphology On modified Leeming & Notman medium at 34°C after 14 days, colonies buff to tan, raised, smooth to wrinkled, margin lobed. Cells elongated ellipsoidal, smooth, 1.5-6 x 1.5-2.25 µm. Pseudohyphae not observed.
Medium ATCC® Medium 2737: Modified Leeming & Notman Agar (MLNA)
ATCC® Medium 2693: modified Dixon (mDixon)
Growth Conditions
Temperature: 30°C to 34°C
Atmosphere: Typical aerobic
Sequenced Data
D1D2 region of the 28S ribosomal RNA gene; GenBank number JQ958299:

GGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGAGGGAAGAGCTCAAATTTGAAAGCTGGTACCTCCGGTATCCGCGTTGTAACCTCGAGACACGTTTTCCGTGCGGCGCTATGGACAAGTTCCTTGGAACAGGACATCGTAGAGGGTGAAAATCCCGTACTTGCCATGGATGTACCGTGCTTTGCGATACGTGCTCTAAGAGTCGAGTTGTTTGGGATTGCAGCTCAAAATGGGTGGTAGACTCCATCTAAAGCTAAATATCGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAGTACGTGAAATTGTCGAAAGGGAAGCGCTTGAAGTCAGCCATGCCGCTCAGGACTCAGCCTGGCTTTTGCTTGGTGTATTTCCTGGGTAGCAAGTCAGCATTGGTTTGGATCGTCGGAGAAGCATAGTCGGAATGTGGCGCCCTCGGGCGTGTTATAGCCTTCTATTGGATACGACGATCTAGACCAAGGAACGCAGCGCGCCTTATGGCGGGTCTTCGGACACCTTCGCGCTTAGGATGCTGGCGTAATGGCTTTAAGTGG

Morphology On modified Leeming & Notman medium at 34°C after 14 days, colonies buff to tan, raised, smooth to wrinkled, margin lobed. Cells elongated ellipsoidal, smooth, 1.5-6 x 1.5-2.25 µm. Pseudohyphae not observed.
Name of Depositor A Zinkeviciene
Special Collection ATCC
Chain of Custody
ATCC <-- A Zinkeviciene
Isolation
Face of patient with atopic dermatitis, Vilnius, Lithuania
Cross References

Nucleotide (GenBank) : JQ958299 D1/D2 region of 28S rRNA gene