Rhodotorula graminis di Menna, anamorph (ATCC® MYA-4893)

Strain Designations: FGSC 10291 [WP1]  /  Product Format: frozen

Permits and Restrictions

View Permits

Strain Designations FGSC 10291 [WP1]
Synonym Pichia rosa Nishiwaki, teleomorph
Biosafety Level 1
Product Format frozen
Type Strain no
Preceptrol® no
Genome Sequenced Strain

Yes

Comments
Genome sequencing strain (the Joint Genome Institute at the Department of Energy, USA)
Morphology On YM medium at 25°C after 9 days, colonies orange to reddish orange with very thin white margin, smooth, mucoid. Cells ovoid to ellipsoidal, smooth, 4.5-6.75 X 3-4.5µm. Pseudohyphae not observed.
Medium ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 1245: YEPD
Growth Conditions
Temperature: 20°C to 25°C
Atmosphere: Typical Aerobic
Sequenced Data
>18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence; GenBank number JX174052:

AAGGATCATTAGTGAATCTAGGACGTCCAACTTAACTTGGAGTCCGAACTCTCACTTTCTAACCCTGTGCATCTGTTAAATTGGACTAGTAGCTCTTCGGAGTGAACCGCCATTCACTTATAAACACAAAGTCTATGAATGTATACAAATTTATAACAAAACAAAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATCTTCAACCCACCTCTTTCTTAGTGAATCTGGTGGTGCTTGGTTTCTGAGCGCTGCTCTGCTTCGGCTTAGCTCGTTCGTAATGCATTAGCATCCGCAACCGAACTTCGGATTGACTTGGCGTAATAGACTATTCGCTGAGGATTCTAGTTTTACTAGAGCCGAGTTGGGTTAAAGGAAGCTCCTAATCCTAAAGTCTATTTTTTGATTAGATCTCAAATCAGGTAGGACTACCCGCTGAACTTAAG
>D1D2 region of the 28S ribosomal RNA gene; GenBank number JX174041:

ATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAGCGGCGAGCGAAGCGGGAAGAGCTCAAATTTATAATCTGGCACCTTCGGTGTCCGAGTTGTAATCTCTAGAAGTGTTTTCCGCGTTGGACCGCACACAAGTCTGTTGGAATACAGCGGCATAGTGGTGAAACCCCCGTATATGGTGCGGACGCCCAGCGCTTTGTGATACACTTTCAATGAGTCGAGTTGTTTGGGAATGCAGCTCAAATTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAACAGTACGTGAAATTGTTGGAAGGGAAACGCTTGAAGTCAGACTTGCTTGCCGGAGCTTGCTTCGGTTTGCAGGCCAGCATCAGTTTTCCGGGGTGGATAATGACGGTTTGAAGGTAGCAGTCTCGGCTGTGTTATAGCTTTCCGTTGGATACATCCTGGGGGACTGAGGAACGCAGCGTGCTTTTTGCGAAAGACTCGTCTTTTTCACGCTTAGGATGCTGGTGGAATGGCTTTAAACGA
Morphology On YM medium at 25°C after 9 days, colonies orange to reddish orange with very thin white margin, smooth, mucoid. Cells ovoid to ellipsoidal, smooth, 4.5-6.75 X 3-4.5µm. Pseudohyphae not observed.
Name of Depositor FGSC
Special Collection ATCC
Chain of Custody
ATCC <-- FGSC
Isolation
Stems of wild cottonwood (Populus trichocarpa), Three Forks Park, King County, Washington, USA.
Cross References

Nucleotide (GenBank) : JX174052 ITS including 5.8S rRNA gene

Nucleotide (GenBank) : JX174041 D1/D2 region of 28S rRNA gene

References

Xin G, et al. Characterization of three endophytic, indole-3-acetic acid-producing yeasts occurring in Populus trees. Mycol. Res. 113: 973-980, 2009. PubMed: 19539760

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation