Phytophthora riparia Reeser et al. (ATCC® MYA-4882)

Strain Designations: VI 3-100B9F [CBS 132024]  /  Product Format: frozen

Classification Peronosporaceae, Phytophthora, riparia
Strain Designations VI 3-100B9F [CBS 132024]
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Type Strain yes
Preceptrol® no
Comments
Plant pathogen
Morphology After 5 days on V8 juice medium at 20°C colonies are angular and petaloid with hyphae appressed. After 3 weeks no sporangia was observed.  Oogonia absent.
Sequenced Data
GenBank accession number: JQ745262

18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

GATCATTACCACACCTAAAAAACTTTCCACGTGAACCGTATCAACCCCTATAATTTGGGGGCTTGCTCGGCGGCGTGCGTGCTGGCCTGTAATGGGTCGGCGTGCTGCTGCTGGGCGGGCTCTATCATGGGCGAGCGCTTGGGCTTCGGCTCGAGCTAGTAGCTTTCCTTTTAAACCCATTCTTTAAATACTGAACATACTGTGGGGACGAAAGTCTCTGCTTTTAACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAACCTTGGTTTTCTTCCTTCCGTGTAGTCGGTGGAGGATATGCCAGACGTGAAGTGTCTTGCTGGCGGTCTTTCGAGTCTGCCGGTGAGTCCTTTGAAATGTACTGAACTGTACTCTCTCTTTGCTCCAAAAGCGTGGCGTTGCTGGTTGTGGAGGCTGCCCGTGTGGCCAGTCGGCGACCGGTTTGTTAGCTGTGGCGTTTAATGGAGGAGTGTTCGATTCGCGGTATGGTTGGCTTCGGCTGAACAATCTGCTTATTGGGTGCTTTTCCTGCTGCAGCGGTATGAACTGGTGAACCGTAGCTGTGTGGTGCTTGGCTTTTGAACCGGCTTTGCTTTGCGAAGTAGGGTGGCGGCTTCGGCTGTCGAGGGGTCGATCCATTTTGGGAAAGTTTGTGTGTGCGGCTTCGTGCTGCGCGCATCTCAATTGGACCTGATATCAGGCAAGATTACCCGCTGAACTTAAG

GenBank accession number: JQ745269

Large subunit ribosomal RNA gene, partial sequence.

CATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTGGCTCGTGCGTACGACCCGTGTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGCGAGTGTGTGCGTGCGTGCGCTGTGGCAGTGGCTTTTTTGGCTGCGCTCGGTGCGTGTGTTGTGCGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCTGCGTTTGTCTATTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGGGTGTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGTGCCTTAACTTGTCGCCGTTCGGGACGTTGACGAAATGGAGCGATCCGAC

Morphology After 5 days on V8 juice medium at 20°C colonies are angular and petaloid with hyphae appressed. After 3 weeks no sporangia was observed.  Oogonia absent.
Name of Depositor E Hansen
Special Collection ATCC
Chain of Custody
ATCC <-- E Hansen <-- P Remigi
Isolation
Forest streams, Oak Creek, Oregon, USA
Cross References

Nucleotide (GenBank) : JQ745262 ITS including 5.8S rRNA gene

Nucleotide (GenBank) : JQ745269 D1/D2 region of the 28S rRNA gene.

References

Hansen EM, et al. Phytophthora borealis and Phytophthora riparia, new species in Phytophthora ITS clade 6. Mycologia 104: 1133-1142. PubMed: 22778166