Malassezia globosa Midgley, E. Guého et J. Guillot (ATCC® MYA-4889)

Strain Designations: M15  /  Product Format: frozen

Permits and Restrictions

View Permits

Strain Designations M15
Biosafety Level 2

Biosafety  classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Type Strain no
Preceptrol® no
Comments
Clinical isolate
Lipid dependent
Morphology On modified Leeming & Notman medium at 30°C after 7 days, colonies creamy white to dingy white, raised, smooth to wrinkled, with a lobed margin. Cells globose to subglobose, smooth, 5.25-7.5 X 4.5-6.75 µm. Pseudohyphae not observed.
Medium ATCC® Medium 2737: Modified Leeming & Notman Agar (MLNA)
ATCC® Medium 2693: modified Dixon (mDixon)
Growth Conditions
Temperature: 30°C to 34°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal   transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence; GenBank number JQ958303:

TACAGACGTACAATAAGTGTGTCTCTGGCGGCTCGTATCCACTATACATCCATAAACCCGTGTGCACTGTTAAGGAGTAAGAAAGAAGGGGAGGGAGAGAGTGCATGTGCTTTGCATATAACTCTCTCTCTTTCTCTTCCTTTCTCTCTCTGGTTAATTACACAAACTCGTATGGATTTGTATGAACGTGAGATATATCGTTGGACCGTCACTGGCCAACAAATATAACACAACTTTCGACAACGGATCTCTTGGTTCTCCCATCGATGAAGAACGCAGCGAAACGCGATAGGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCTATGGTATTCCGTAGAGCATGCCTGTTTGAGTGCCGTGAATTCTCCCATCCCAAGCGGTTTTTATCAAAGAATTGCTAGGCGAAGGGGTTGAGATGGGCGTTGTTATAACTGCTTTTCTTCTCTAGAAAAGCTCGCCCGAAAAACAGCTAACGCCTCTGGGCCACTTTGCATCCGCTTCTCTGAGGGGAGAAGCGGCCAAGCGCGCTCTGATCATCAGGCATAGCATGATACGTCATTTGCTATGCTGTAGGAGAGCATTTGGTTGTGGTTATACCGCGTGCGTTATTTTTTTTTT

 

D1D2 region of the 28S ribosomal RNA gene; GenBank number JQ958301:

ATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACGGCGAGCGAAGCGGGAAGAGCTCAAATTTGAAAGCTGGCACCTCCGGTGTCCGCGTTGTAATCTCGAGACGTGTTTTCCGTGCGGCTCTATGGACAAGTCCCTTGGAATAGGGCATCGTAGAGGGTGAGAATCCCGTACTTGCCATGGAAGAACCGTGCTTTGCGATACACGCTCTAAGAGTCGAGTTGTTTGGGATTGCAGCTCAAAATGGGTGGTAGACTCCATCTAAAGCTAAATATCGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAGTACGTGAAATTGTCGAAAGGGAAGCACTTGAAGTCAGCCATGCTGCTTGAGACTCAGCCTGGCCTTTGGGCTTGGTGTATTTCTCGGTGGCAAGCCAGCATTGGTTTGGGTCGTCGGAGAAGCGCATAGGGAATGTAGCGTCTCCGGACGTGTTATAGCCTTATGCAGGATACGACGACCTGGATCAAGGAACGCAGTGTGCCCTCTGGGCGGGTCTTCGGACACCTTCACACTTAGGATGCTGGCGTAATGGCTTTAAGTGG

Morphology On modified Leeming & Notman medium at 30°C after 7 days, colonies creamy white to dingy white, raised, smooth to wrinkled, with a lobed margin. Cells globose to subglobose, smooth, 5.25-7.5 X 4.5-6.75 µm. Pseudohyphae not observed.
Name of Depositor A Zinkeviciene
Special Collection ATCC
Chain of Custody
ATCC <-- A Zinkeviciene
Isolation
Patient with atopic dermatitis, Vilnius, Lithuania
Cross References

Nucleotide (GenBank) : JQ958303 ITS including 5.8S rRNA gene

Nucleotide (GenBank) : JQ958301 D1/D2 region of 28S rRNA gene

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation