Candida guilliermondii (Castellani) Langeron et Guerra (ATCC® 6260)

Alternate State: Yamadazyma guilliermondii (Wickerham) Billon-Grand, Meyerozyma guilliermondii (Wickerham) Kurtzman et Suzuki  /  Strain Designations: [ATCC 7350, CBS 566, DBVPG 6140, IFO 10279, IGC 2730, JCM 1539, NRRL Y-324]  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Deposited As Monilia guilliermondii (Castellani) Castellani et Chalmers, anamorph
Strain Designations [ATCC 7350, CBS 566, DBVPG 6140, IFO 10279, IGC 2730, JCM 1539, NRRL Y-324]
Synonym Monilia guilliermondii
Alternate State Yamadazyma guilliermondii (Wickerham) Billon-Grand, Meyerozyma guilliermondii (Wickerham) Kurtzman et Suzuki
Application
Produces riboflavin vitamin B2
Quality control strain
Quality control strain for API products
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain yes
Preceptrol® yes
Genome Sequenced Strain

Yes

Comments
Genome sequencing strain (Broad Institute, USA).
Morphology On YM medium at 25°C after 4 days, colonies creamy white to dingy white, butyrous, dull, smooth, margin entire. Cells hyaline, ellipsoidal, smooth, 4-5.5 X 2.5-4 µm. Pseudohyphae not observed.
Sequenced Data
5.8S ribosomal RNA gene, partial sequence, internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence:

GATATGCTTAAGTTCAGCGGGTATTCCTACCTGATTTGAGGTCAAGCTTGTTTGGTTGTTGTAAGGCCGGGCCAACAATACCAGAAATATCCCGCCACACCATTCAACGAGTTGGATAAACCTAATACATTGAGAGGTCGACAGCACTATCCAGTACTACCCATGCCAATACTTTTCAAGCAAACGCCTAGTCCGACTAAGAGTATCACTCAATACCAAACCCGGGGGTTTGAGAGAGAAATGACGCTCAAACAGGCATGCCCTCTGGAATACCAGAGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACGAAAATCTGCAATTCATATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAACCAAGAGATCCGTTGTTGAAAGTTTTGAAGATTAATTCAAAATTTGACTAACTGTAAAAATAATTAAATTGTGTTTTGTTAAACCTCTGGCCCAACCTATCTCTAGGCCAAACCAAAGCAAGAGTTCTGTATCAAAAAGACACTGTGTGTAAGGTTTTTCGCCGCGCAGTTAAGCGCTGGCAAAAGAATACTGTAATGATCCTTCCGCA


D1D2 region of the 28S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAGCGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCGCCTTCGGTGTCCGAGTTGTAATTTGAAGATTGTAACCTTGGGGTTGGCTCTTGTCTATGTTTCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGCCCAATTCTATGTAAGGTGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGTTTGAGATCAGACTCGATATTTTGTGAGCCTTGCCTTCGTGGCGGGGTGACCCGCAGCTTATCGGGCCAGCATCGGTTTGGGCGGTAGGATAATGGCGTAGGAATGTGACTTTACTTCGGTGAAGTGTTATAGCCTGCGTTGATGCTGCCTGCCTAGACCGAGGACTGCGATTTTATCAAGGATGCTGGCATAATGATCCCAAACCG

Morphology On YM medium at 25°C after 4 days, colonies creamy white to dingy white, butyrous, dull, smooth, margin entire. Cells hyaline, ellipsoidal, smooth, 4-5.5 X 2.5-4 µm. Pseudohyphae not observed.
Name of Depositor A Castellani
Isolation
Sputum from patient with bronchomycosis
Cross References

Nucleotide (GenBank) : M60304 C.guilliermondii small subunit ribosomal RNA.

Nucleotide (GenBank) : AF218967 Pichia guilliermondii strain ATCC 6260T 5.8S ribosomal RNA gene

Complete Genome (GenBank) : AAFM00000000 Meyerozyma guilliermondii ATCC 6260, whole genome shotgun sequencing project

References

Tanner FW Jr., et al. Riboflavin production by Candida species. Science 101: 180-181, 1945.

Castellani AJ. Observations on the fungi found in tropical bronchomycosis. Lancet 1: 13-15, 1912.

Thanos M, et al. Rapid identification of Candida species by DNA fingerprinting with PCR. J. Clin. Microbiol. 34: 615-621, 1996. PubMed: 8904425

API 20C AUX. bioMerieux.

Butler G, et al. Evolution of pathogenicity and sexual reproduction in eight Candida genomes. Nature 459: 657-662, 2009. PubMed: 19465905

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation