Acremonium alcalophilum Okada (ATCC® 90507)

Strain Designations: JCM 7366 [CBS 114.92, IMI 351927, PA-2M]  /  Product Format: frozen

Permits and Restrictions

View Permits

Deposited As Acremonium alcalophilum Okada
Strain Designations JCM 7366 [CBS 114.92, IMI 351927, PA-2M]
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain yes
Preceptrol® no
Genome Sequenced Strain

Yes

Comments
Genome sequencing strain (the Joint Genome Institute (JGI) at the Department of Energy, USA).
Medium ATCC® Medium 2758: Oatmeal Agar w/ 2N KOH
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

TGCGGAGGGATCATTACAGAGTGTTTTTCCAACCTCATAACCCTATGTGAACCTATATACCACGTTGCTTCGGCGGCGCGTCCCCCCGGGGTCGTGCCCGCCGGCGTTAACCAGTCTCTCAGTCATGAACCGACGTTACTTCTGAGTGTTCTAAGCGAACTGTTAAAACTTTCAACAACGGATCTCTTGGCTCCAGCATCGATGAAGAACGCAGCGAAACGCGATATGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCTCCCAGTATCCTGGGAGGCATGCCTGTCCGAGCGTCGTTTCAACCCTCGAGCCCCCGTGGCCCGGTGTTGGGGAACCGCGAGCGAGAGCTCCCGCGGTCCCCGAAATGCAGTGGCGGTCCCGCAGCGTCCCGGCCCTTTGCGTAGTAATTATCGCTCGCATTGGCAGGCCCGCGGGTTACCAGCCTTGAAACCCCCTACAAAGACCGCTCCGGCGGCACGGTTGACCTCGGATCAGGTAGGACTACCCGCTGAACTTAAGCATATCATA


D1D2 region of the 28S ribosomal RNA gene

CATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCCTTCGGGGCCCGAGTTGTAATTTGCAGAGGATGCCTCGGGTGCGGGTTCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCAGGTCGGAAACCTAGCCCGTGTGAGGCTCCCTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAGGGGAGGTATACTCCTTCCAAAGCTAAATACCGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTCGCTACCAGACTTGGGTCCGCGGCTCACCCGGTGCTCCGCACCGGTGCATTCCGCGGGCCCAGGCCAGCATCAGCTCTCCGTCAGGTTCAAAGGCTTCGGGAATGTAGCTCCCCCTCGGGGGAGTGTTATAGCCCGTTGCGTCATGCCTCTCGGGGGGCTGAGGTTCGCGCATCTGCAAGGATGCTGGCGTAATGGTAGCTAGTGAC

Name of Depositor JCM
Chain of Custody
ATCC <-- JCM <-- G. Okada PA-2M
Isolation
Sludge of pig manure compost, Kanagawa, Japan
Cross References

Nucleotide (GenBank) : KC146367 ITS including 5.8S rRNA gene

Nucleotide (GenBank) : KC146383 D1/D2 region of 28S rRNA

References

Grum-Grzhimaylo AA, et al. Sodiomyces alkalinus, a new holomorphic alkaliphilic ascomycete within the Plectosphaerellaceae. Persoonia 31: 147-158, 2013. PubMed: 24761040

Kiyuna T, et al. Molecular assessment of fungi in "black spots" that deface murals in the Takamatsuzuka and Kitora Tumuli in Japan: Acremonium sect. Gliomastix including Acremonium tumulicola sp. nov. and Acremonium felinum comb. nov. Mycoscience 52: 1-17, 2011.

Summerbell RC, et al. Acremonium phylogenetic overview and revision of Gliomastix, Sarocladium, and Trichothecium. Stud. Mycol. 68: 139-162, 2011. PubMed: 21523192

Zare R, et al. Gibellulopsis, a suitable genus for Verticillium nigrescens, and Musicillium, a new genus for V. theobromae. Nova Hedwigia 85: 463-489, 2007.

Okada G, et al. Acremonium alcalophilium, a new alkalophilic celluloytic hyphomycete. Trans. Mycol. Soc. Jpn. 34: 171-185, 1993.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation