Saccharomyces cerevisiae Meyen ex E.C. Hansen (ATCC® 26422)

Alternate State: Candida robusta Diddens et Lodder  /  Strain Designations: Kyokai 7 [VTT C-79099]  /  Product Format: freeze-dried

Deposited As Saccharomyces sake Yabe
Classification Saccharomycetes, Saccharomycetidae, Saccharomycetales, Saccharomycetaceae, Saccharomycetaceae, Saccharomyces, cerevisiae
Strain Designations Kyokai 7 [VTT C-79099]
Alternate State Candida robusta Diddens et Lodder
Application
Produces alcohol acetyltransferase
Diploid transformation host
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Genome Sequenced Strain

Yes

Comments
Stress tolerance
Internal peptide sequences of alcohol acetyltransferase
Tolerant to brief heat and oxidative stress
Genome sequencing strain (National Institute of Technology and Evaluation (NITE), Japan).
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

AAGGATCATTAAAGAAATTTAATAATTTTGAAAATGGATTTTTTTGTTTTGGCAAGAGCATGAGAGCTTTTACTGGGCAAGAAGACAAGAGATGGAGAGTCCAGCCGGGCCTGCGCTTAAGTGCGCGGTCTTGCTAGGCTTGTAAGTTTCTTTCTTGCTATTCCAAACGGTGAGAGATTTCTGTGCTTTTGTTATAGGACAATTAAAACCGTTTCAATACAACACACTGTGGAGTTTTCATATCTTTGCAACTTTTTCTTTGGGCATTCGAGCAATCGGGGCCCAGAGGTAACAAACACAAACAATTTTATTTATTCATTAAATTTTTGTCAAAAACAAGAATTTTCGTAACTGGAAATTTTAAAATATTAAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCAGGGGGCATGCCTGTTTGAGCGTCATTTCCTTCTCAAACATTCTGTTTGGTAGTGAGTGATACTCTTTGGAGTTAACTTGAAATTGCTGGCCTTTTCATTGGATGTTTTTTTTTCCAAAGAGAGGTTTCTCTGCGTGCTTGAGGTATAATGCAAGTACGGTCGTTTTAGGTTTTACCAACTGCGGCTAATCTTTTTTATACTGAGCGTATTGGAACGTTATCGATAAGAAGAGAGCGTCTAGGCGAACAATGTTCTTAAAGTTTGACCTCAAATCAGGTAGGAGTACCCGCTGAACTTAAG


D1D2 region of the 26S ribosomal RNA gene

CATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGTACCTTCGGTGCCCGAGTTGTAATTTGGAGAGGGCAACTTTGGGGCCGTTCCTTGTCTATGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTGTGGCGAGGAGTGCGGTTCTTTGTAAAGTGCCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGTGTTTTGTGCCCTCTGCTCCTTGTGGGTAGGGGAATCTCGCATTTCACTGGGCCAGCATCAGTTTTGGTGGCAGGATAAATCCATAGGAATGTAGCTTGCCTCGGTAAGTATTATAGCCTGTGGGAATACTGCCAGCTGGGACTGAGGACTGCGACGTAAGTCAAGGATGCTGGCATAATGGTTATATGCCG

Name of Depositor Research Institute of Brewing, Japan
Isolation
Sake yeast
Cross References

Complete Genome (GenBank) : BABQ00000000 Saccharomyces cerevisiae Kyokai no. 7, whole genome shotgun sequencing project

References

Akao T, et al. Whole-genome sequencing of sake yeast Saccharomyces cerevisiae Kyokai no. 7. DNA Res 18: 423-434, 2011. PubMed: 21900213

Lewis JG, et al. Induction of heat, freezing and salt tolerance by heat and salt shock in Saccharomyces cerevisiae. Microbiology 141: 687-694, 1995. PubMed: 7711907

Steels EL, et al. Stress tolerance and membrane lipid unsaturation in Saccharomyces cerevisiae grown aerobically and anaerobically. Microbiology 140: 569-576, 1994. PubMed: 8012580

Suizu T, et al. Introduction of a feed back resistant à-isopropylmalate synthase gene of Saccharomyces cerevisiae into sake yeast. J Ferment Bioeng 77: 119-124, 1994.

Minetoki T, et al. The purification, properties and internal peptide sequences of alcohol acetyltransferase isolated from Saccharomyces cerevisiae Kyokai No. 7. Biosci Biotechnol Biochem 57: 2094-2098, 1993. PubMed: 7764365

. . J. Ferment. Technol. 51: 85-95, 1973.

. . J. Ferment. Technol. 51: 551-559, 1973.

. . J. Ferment. Technol. 49: 959-967, 1971.

Agric. Biol. Chem. 35: 1024-1032, 1971.

Agric. Bull. Saga Univ. 14: 199-208, 1970.

. . J. Soc. Brew. 58: 583-587, 1963.

. . J. Soc. Brew. 42: 26, 1947.