Trichophyton interdigitale Priestley (ATCC® 28283)

Strain Designations: [RV 25921]  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Deposited As Arthroderma vanbreuseghemii Takashio
Strain Designations [RV 25921]
Application
Biomedical Research and Development Material
Biosafety Level 2

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Mating Type plus
Comments This fungus has been known as Arthroderma vanbreuseghemii, but was re-identified recently as Trichophyton interdigitale based on the multigene sequence comparisons.
Medium ATCC® Medium 28: Emmons' modification of Sabouraud's agar
ATCC® Medium 200: YM agar or YM broth
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAGCGCGCAGGCCGGAGGCTGGCCCCCCACGATAGGGCCAAACGTCCGTCAGGGGTGAGCAGATGTGCGCCGGCCGTACCGCCCCATTCTTGTCTACATTACTCGGTTGCCTCGGCGGGCCGCGCTCTCCCAGGAGAGCCGTTCGGCGAGCCTCTCTTTAGTGGCTAAACGCTGGACCGCGCCCGCCGGAGGACAGACGCAAAAAAATTCTTTCAGAAGAGCTGTCAGTCTGAGCGTTAGCAAGCAAAAATCAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGCATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCAGCCCCTCAAGCCCGGCTTGTGTGATGGACGACCGTCCGGCGCCCCCGTCTTTGGGGGTGCGGGACGCGCCCGAAAAGCAGTGGCCAGGCCGCGATTCCGGCTTCCTAGGCGAATGGGCAACAAACCAGCGCCTCCAGGACCGGCCGCCCTGGCCTCAAAATCTGTTTTATACTTATCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAA


D1D2 region of the 28S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAATCTGGCCTCCCCCGGGGGCCCGAGTTGTAATTTGCAGAGGATGCTTCGGGTGCGGCCGCCGTCTAAGTTCCTTGGAACAGGACGTCAGAGAGGGTGAGAATCCCGTCTTGGGCGGGCGGTCCGCGCCCGTGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGCGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGGTTAAAAGCACCTTGAAAAGGGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCGGCCAGACTCGGGGGCGGGGTTCAGCGGGTGCTCGTCGCCCGTGTATTCCTCGTCTCCCGGGCCAGCATCAGTTTCGACGGCCGGTCAAAGGCCCCCGGAATGTGTCGTCTCTCGGGACGTCTTATAGCCGGGGGTGCAATGCGGCCCGTCGGGACTGAGGAACGCGCTCCGGCTCGGATGCTGGCGTAATGGCCGTAAGCGGC


beta-tubulin gene

CTAGCTTTCCCCCTGTCCATCACTTCCCCTCTATTTGTGCCCGAAAAACACGACACGGTCTGCACAGGCCAAGAAAGGGGGGGAGGCGAGGGCCACCACACGACCACGTCCCAGCGTGAAGGGGACAGGCTTCGAGTTTCACAATTCTCGCATAGCGAGCTTCGAGCATCAGGCTAACGTGCATTTATCGTATAGGTCCATCTCCAAACCGGCCAATGTGTAAGCTTTGATCGTTCCCTGGTTCGTTCTCAGGTACCCGTTTGAGTTAACAATTGTTCGACATTAGGGTAACCAAATTGGTGCTGCTTTCTGGTGAGCATTCATGCGTTGCAGCATAATTGTATATTTCGTGTCGAGTTGTTACTGACTTGGTTTACAGGCAAACCATTGCTGGTGAGCACGGTCTCGATGGATCCGGCCAGTGAGTGATTCTGCAAGAAAAAGTTCCGGTCTTGAGGGACTTGAACGTTGACAACTGGGATTTCTATAGCTACACCGGATCTTCTGACCTCCAATTGGAGCGCATGAATGTCTACTTCAACGAGGTGTGCACGACCAAGACCCTTCCCTTCAGCAGCATACTAACTCATTGGAGGCAAAGGCCTCAAGCAAAAAATACGTTCCCCGTGCGGTTCTTGTTGATCTTGAGCCCGCCGCTCTCGATGCTGTCCGCGCCGGTCCTTTTGGTCAGCTCTTCCGCCCCGATAACGTCGTCTTCGGTCAGTCTGGTGCCGGAAACAACTGG

Name of Depositor AA Padhye
Chain of Custody
ATCC <-- AA Padhye <-- R. Vanbreuseghem RV 25921
Isolation
Human, Belgium
Cross References

Nucleotide (GenBank) : KJ606111 ITS including 5.8S rRNA gene

Nucleotide (GenBank) : KJ606159 D1/D2 region of 28S rRNA gene

Nucleotide (GenBank) : KJ606207 beta-tubulin gene

References

Takashio M. Etudes des phénoménes de reproduction liés au vieillissement et au rajeunissement des cultures de champignons. Ann Soc Belge Med Trop 53: 427-580, 1973.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation