Aspergillus terreus Thom, anamorph (ATCC® MYA-4897)

Strain Designations: TUB F-514  /  Product Format: frozen

Permits and Restrictions

View Permits

Strain Designations TUB F-514
Application
Produces lovastatin (mevinolin)
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Type Strain no
Preceptrol® no
Morphology On PDA medium at 25°C after 12 days, Mycelium white to pale yellow, dense, in tufts. Conidia tan to light brown with a powdery texture. Turns media bright yellow. Reverse reddish brown. Conidial heads clavate to pyriform, vesicles 10.25-25 X 15-21 µm. Conidia reddish brown in mass, globose to subglobose, 2.25-3 X 2.25-3 µm.
Medium ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 336: Potato dextrose agar (PDA)
ATCC® Medium 324: Malt extract agar
Growth Conditions
Temperature: 20°C to 25°C
Atmosphere: Typical Aerobic
Sequenced Data
>18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence; GenBank number JX174056:

AAGGATCATTACCGAGTGCGGGTCTTTATGGCCCAACCTCCCACCCGTGACTATTGTACCTTGTTGCTTCGGCGGGCCCGCCAGCGTTGCTGGCCGCCGGGGGGCGACTCGCCCCCGGGCCCGTGCCCGCCGGAGACCCCAACATGAACCCTGTTCTGAAAGCTTGCAGTCTGAGTGTGATTCTTTGCAATCAGTTAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGCCCTCGTCCCCCGGCTCCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTCGTCTTCCGCTCCGTAGGCCCGGCCGGCGCCCGCCGACGCATTTATTTGCAACTTGTTTTTTTTTCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAG
>D1D2 region of the 28S ribosomal RNA gene; GenBank number JX174045:

ATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAAGCTGGCTCCTTCGGGGTCCGCATTGTAATTTGCAGAGGATGCTTCGGGTGCAGCCCCCGTCTAAGTGCCCTGGAACGGGCCGTCATAGAGGGTGAGAATCCCGTATGGGGCGGGGTGTCTGCGTCCGTGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTCGCTCGCGGGGTTCAGCCGGGCTTCGGCCCGGTGTACTTCCCCGCGGGCGGGCCAGCGTCGGTTTGGGCGGCCGGTCAAAGGCCTCCGGAATGTAGCGCCCTTCGGGGCGCCTTATAGCCGGGGGTGCAATGCGGCCAGCCTGGACCGAGGAACGCGCTTCGGCACGGACGCTGGCATAATGGTTGTAAACGA
Morphology On PDA medium at 25°C after 12 days, Mycelium white to pale yellow, dense, in tufts. Conidia tan to light brown with a powdery texture. Turns media bright yellow. Reverse reddish brown. Conidial heads clavate to pyriform, vesicles 10.25-25 X 15-21 µm. Conidia reddish brown in mass, globose to subglobose, 2.25-3 X 2.25-3 µm.
Name of Depositor G Szakacs
Special Collection ATCC
Chain of Custody
ATCC <-- G Szakacs
Isolation
Soil, Bagdad, Iraq
Geographical Isolation Bagdad, Iraq
Cross References

Nucleotide (GenBank) : JX174056 ITS including 5.8S rRNA gene

Nucleotide (GenBank) : JX174045 D1/D2 region of 28S rRNA gene

References

Szakacs G, et al. Production of lovastatin by a wild strain of Aspergillus terrus. Biotechnol. Lett. 20(4): 411-415, 1998.

Morovjan G, et al. Monitoring of selected metabolites and biotransformation products from fermentation broths by high-performance liquid chromatography. J. Chromatogr. A. 763: 165-172, 1997.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation