Aspergillus fumigatus (ATCC® MYA-4896)

Strain Designations: TUB F-266  /  Product Format: frozen

Permits and Restrictions

View Permits

Strain Designations TUB F-266
Application
Produces fumagillin
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Type Strain no
Preceptrol® no
Morphology On malt extract medium at 25°C after 12 days, cream to tan mycelium with a thick layer of powdery dark green spores. Reverse tan. Conidial heads pyriform, 13.5-20 X 14-18 µm, uniseriate. Phialides obclavate to mucronate. Conidia green, globose to subglobose, punctate to verrucose, 4.5-5.25 X 4.5 µm.
Medium ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 336: Potato dextrose agar (PDA)
ATCC® Medium 324: Malt extract agar
Growth Conditions
Temperature: 20°C to 25°C
Atmosphere: Typical Aerobic
Sequenced Data
>18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence; GenBank number JX174055:

TGCGGAAGGATCATTACCGAGTGAGGGCCCTCTGGGTCCAACCTCCCACCCGTGTCTATCGTACCTTGTTGCTTCGGCGGGCCCGCCGTTTCGACGGCCGCCGGGGAGGCCTTGCGCCCCCGGGCCCGCGCCCGCCGAAGACCCCAACATGAACGCTGTTCTGAAAGTATGCAGTCTGAGTTGATTATCGTAATCAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCCCCCGTCCCCCTCTCCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCTGCTCTGTAGGCCCGGCCGGCGCCAGCCGACACCCAACTTTATTTTTCTAAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAG
>D1D2 region of the 28S ribosomal RNA gene; GenBank number JX174044:

ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAAGCTGGCCCCTTCGGGGTCCGCGTTGTAATTTGCAGAGGATGCTTCGGGTGCAGCCCCCGTCTAAGTGCCCTGGAACGGGCCGTCATAGAGGGTGAGAATCCCGTCTGGGACGGGGTGTCTGCGTCCGTGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACTCGCCCGCGGGGTTCAGCCGGCATTCGTGCCGGTGTACTTCCCCGTGGGCGGGCCAGCGTCGGTTTGGGCGGCCGGTCAAAGGCCCTCGGAATGTATCACCTCTCGGGGTGTCTTATAGCCGAGGGTGCAATGCGGCCTGCCTGGACCGAGGAACGCGCTTCGGCTCGGACGCTGGCGTAATGGTCGTAAATGA
Morphology On malt extract medium at 25°C after 12 days, cream to tan mycelium with a thick layer of powdery dark green spores. Reverse tan. Conidial heads pyriform, 13.5-20 X 14-18 µm, uniseriate. Phialides obclavate to mucronate. Conidia green, globose to subglobose, punctate to verrucose, 4.5-5.25 X 4.5 µm.
Name of Depositor G Szakacs
Special Collection ATCC
Chain of Custody
ATCC <-- G Szakacs
Isolation
Soil in Eucalyptus forest, San Francisco area, California, USA.
Cross References

Nucleotide (GenBank) : JX174055 ITS including 5.8S rRNA gene

Nucleotide (GenBank) : JX174044 D1/D2 region of 28S rRNA gene

References

Morovjan G, et al. Monitoring of selected metabolites and biotransformation products from fermentation broths by high-performance liquid chromatography. J. Chromatogr. A. 763: 165-172, 1997.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation