Rhodotorula graminis di Menna (ATCC® MYA-4893)

Strain Designations: FGSC 10291 [WP1]  /  Product Format: frozen

Strain Designations FGSC 10291 [WP1]
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Genome Sequenced Strain

Yes

Comments
Genome sequencing strain (the Joint Genome Institute at the Department of Energy, USA)
Morphology On YM medium at 25°C after 9 days, colonies orange to reddish orange with very thin white margin, smooth, mucoid. Cells ovoid to ellipsoidal, smooth, 4.5-6.75 X 3-4.5µm. Pseudohyphae not observed.
Medium ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 323: Malt agar medium
ATCC® Medium 1245: YEPD
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence<

AAGGATCATTAGTGAATCTAGGACGTCCAACTTAACTTGGAGTCCGAACTCTCACTTTCTAACCCTGTGCATCTGTTAAATTGGACTAGTAGCTCTTCGGAGTGAACCGCCATTCACTTATAAACACAAAGTCTATGAATGTATACAAATTTATAACAAAACAAAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATCTTCAACCCACCTCTTTCTTAGTGAATCTGGTGGTGCTTGGTTTCTGAGCGCTGCTCTGCTTCGGCTTAGCTCGTTCGTAATGCATTAGCATCCGCAACCGAACTTCGGATTGACTTGGCGTAATAGACTATTCGCTGAGGATTCTAGTTTTACTAGAGCCGAGTTGGGTTAAAGGAAGCTCCTAATCCTAAAGTCTATTTTTTGATTAGATCTCAAATCAGGTAGGACTACCCGCTGAACTTAAG


D1D2 region of the 26S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAGCGGCGAGCGAAGCGGGAAGAGCTCAAATTTATAATCTGGCACCTTCGGTGTCCGAGTTGTAATCTCTAGAAGTGTTTTCCGCGTTGGACCGCACACAAGTCTGTTGGAATACAGCGGCATAGTGGTGAAACCCCCGTATATGGTGCGGACGCCCAGCGCTTTGTGATACACTTTCAATGAGTCGAGTTGTTTGGGAATGCAGCTCAAATTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAACAGTACGTGAAATTGTTGGAAGGGAAACGCTTGAAGTCAGACTTGCTTGCCGGAGCTTGCTTCGGTTTGCAGGCCAGCATCAGTTTTCCGGGGTGGATAATGACGGTTTGAAGGTAGCAGTCTCGGCTGTGTTATAGCTTTCCGTTGGATACATCCTGGGGGACTGAGGAACGCAGCGTGCTTTTTGCGAAAGACTCGTCTTTTTCACGCTTAGGATGCTGGTGGAATGGCTTTAAACGA

Morphology On YM medium at 25°C after 9 days, colonies orange to reddish orange with very thin white margin, smooth, mucoid. Cells ovoid to ellipsoidal, smooth, 4.5-6.75 X 3-4.5µm. Pseudohyphae not observed.
Name of Depositor FGSC
Special Collection ATCC
Chain of Custody
ATCC <-- FGSC
Isolation
Stems of wild cottonwood (Populus trichocarpa), Three Forks Park, King County, Washington, USA.
Cross References

Nucleotide (GenBank) : JX174052 ITS including 5.8S rRNA gene

Nucleotide (GenBank) : JX174041 D1/D2 region of 28S rRNA gene

Nucleotide (GenBank) : JTAO00000000 Rhodotorula graminis WP1, whole genome shotgun sequencing project

References

Firrincieli A, et al. Genome sequence of the plant growth promoting endophytic yeast Rhodotorula graminis WP1. Front Microbiol 6: 978, 2015. PubMed: 26441909

Xin G, et al. Characterization of three endophytic, indole-3-acetic acid-producing yeasts occurring in Populus trees. Mycol. Res. 113: 973-980, 2009. PubMed: 19539760