Cylindrocladium pseudonaviculatum Crous et al. (ATCC® MYA-4890)

Strain Designations: S-1  /  Product Format: frozen

Strain Designations S-1
Biosafety Level 1
Product Format frozen
Type Strain no
Preceptrol® no
Comments
Plant pathogen (boxwood blight; causing a leaf spot disease on Pachysandra terminalis)
Morphology On PDA medium at 25°C after 9 days, mycelium has concentric color zonation from reddish brown to buff with patches of dense white cottony mycelium. Produces a tan to dark reddish brown exudate. Hyphae guttulate, hyaline to reddish brown.
Medium ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 336: Potato dextrose agar (PDA)
Growth Conditions
Temperature: 20°C to 25°C
Atmosphere: Typical Aerobic
Sequenced Data
>18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence; GenBank number JX174049:

GGGATCATTACCGAGTTTACAACTCCCAAACCCCATGTGAACATACCTGTTTCGTTCCCTCGGCGGTGTCCGGAAACGGCCCGCCAGAGGACCCAACAAACTCTTTTGAATTTATAGTATCTTCTGAGTGAAAAAAACAATAAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACCTTCGGGAGCTTGGTGTTGGGGATCGGCAGAGCGTCCTCCGGGTCGCGCCGTCCCCCAAATTTAGTGGCGGTCTCGCTGTAGCTTCCTCTGCGTAGTAATACACCTCGCTCTGGAGTCTCGGCGCGGCCACGCCGTAAAACCCCAACTTTTTCTGGTTGACCTCGAATCAGGTAGGACTACCCGCTGAACTTAAG
>D1D2 region of the 28S ribosomal RNA gene; GenBank number JX174038:

ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCTCGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGTGAGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTTGGATACCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTATGACCAGACTTGGGCTTGGTTGATCATCCTGGGTTCTCCCTGGTGCACTCTTCCAGTTCAGGCCAGCATCAGTTCGCTGCGGGGGATAAAAGCTTTGGGAATGTGGCTCCCTCGGGAGTGTTATAGCCCATTGCATAATACCCTGCTCCGGACTGAGGTTCGCGCATCTGCAAGGATGCTGGCGTAATGGTCATCAGCGA
Morphology On PDA medium at 25°C after 9 days, mycelium has concentric color zonation from reddish brown to buff with patches of dense white cottony mycelium. Produces a tan to dark reddish brown exudate. Hyphae guttulate, hyaline to reddish brown.
Name of Depositor JA LaMondia
Special Collection ATCC
Chain of Custody
ATCC <-- J LaMondia
Isolation
Buxus sempervirens 'suffructicosa', Connecicut, USA.
Geographical Isolation Connecticut, USA
Cross References

Nucleotide (GenBank) : JX174049 ITS including 5.8S rRNA gene

Nucleotide (GenBank) : JX174038 D1/D2 region of 28S rRNA gene

References

LaMondia JA, et al. First report of Cylindrocladium pseudonaviculatum causing leaf spot of Pachysandra terminalis. Plant Dis. (in press).