Cylindrocladium pseudonaviculatum Crous et al. (ATCC® MYA-4890)

Strain Designations: S-1  /  Product Format: frozen

Strain Designations S-1
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Type Strain no
Preceptrol® no
Comments
Plant pathogen (boxwood blight; causing a leaf spot disease on Pachysandra terminalis)
Morphology On PDA medium at 25°C after 9 days, mycelium has concentric color zonation from reddish brown to buff with patches of dense white cottony mycelium. Produces a tan to dark reddish brown exudate. Hyphae guttulate, hyaline to reddish brown.
Medium ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 336: Potato dextrose agar (PDA)
Growth Conditions
Temperature: 20°C to 25°C
Atmosphere: Typical Aerobic
Sequenced Data
>18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence; GenBank number JX174049:

GGGATCATTACCGAGTTTACAACTCCCAAACCCCATGTGAACATACCTGTTTCGTTCCCTCGGCGGTGTCCGGAAACGGCCCGCCAGAGGACCCAACAAACTCTTTTGAATTTATAGTATCTTCTGAGTGAAAAAAACAATAAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACCTTCGGGAGCTTGGTGTTGGGGATCGGCAGAGCGTCCTCCGGGTCGCGCCGTCCCCCAAATTTAGTGGCGGTCTCGCTGTAGCTTCCTCTGCGTAGTAATACACCTCGCTCTGGAGTCTCGGCGCGGCCACGCCGTAAAACCCCAACTTTTTCTGGTTGACCTCGAATCAGGTAGGACTACCCGCTGAACTTAAG
>D1D2 region of the 28S ribosomal RNA gene; GenBank number JX174038:

ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCTCGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGTGAGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTTGGATACCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTATGACCAGACTTGGGCTTGGTTGATCATCCTGGGTTCTCCCTGGTGCACTCTTCCAGTTCAGGCCAGCATCAGTTCGCTGCGGGGGATAAAAGCTTTGGGAATGTGGCTCCCTCGGGAGTGTTATAGCCCATTGCATAATACCCTGCTCCGGACTGAGGTTCGCGCATCTGCAAGGATGCTGGCGTAATGGTCATCAGCGA
Morphology On PDA medium at 25°C after 9 days, mycelium has concentric color zonation from reddish brown to buff with patches of dense white cottony mycelium. Produces a tan to dark reddish brown exudate. Hyphae guttulate, hyaline to reddish brown.
Name of Depositor JA LaMondia
Special Collection ATCC
Chain of Custody
ATCC <-- J LaMondia
Isolation
Buxus sempervirens 'suffructicosa', Connecicut, USA.
Geographical Isolation Connecticut, USA
Cross References

Nucleotide (GenBank) : JX174049 ITS including 5.8S rRNA gene

Nucleotide (GenBank) : JX174038 D1/D2 region of 28S rRNA gene

References

LaMondia JA, et al. First report of Cylindrocladium pseudonaviculatum causing leaf spot of Pachysandra terminalis. Plant Dis. (in press).